Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C23G10.4   

sjj_C23G10.4 RNAi JA:C23G10.4
Simmer:C23G10.4
PCR_productsjj_C23G10.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC23G10.4b Source_evidenceePCR973WS150 Sequence/Annotation Release
Overlaps_Gene C23G10.4 Source_evidenceePCR973WS150 Sequence/Annotation Release
Chunk_score Abs_score910
Max_abs_score910C23G10.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII61993146200382
Overlaps_transcript C23G10.4a.2 Source_evidenceePCR973WS150 Sequence/Annotation Release
C23G10.4a.3 Source_evidenceePCR973WS150 Sequence/Annotation Release
C23G10.4a.1 Source_evidenceePCR973WS150 Sequence/Annotation Release
C23G10.4b Source_evidenceePCR973WS150 Sequence/Annotation Release
WB_DNA_textsjj_C23G10.41069ttcttgtgaacacatggtttgaggtcgctgacgcccttccagctgtagagcagctccttgacaacaacacgttcccagagcattcatccgctgcactgctcgtctccaaagtttatttctgcttggagcagtatgaacgtgctttggagtttgctcttcgtggtgatttcaacgtcgttcctgctacaagaaccggtcttggaaacgacgcagaatatgttaacaagatcatcgagacggccattgacacgtacaagacgctgagcaagcaaggatctggaattcctcagaaactccgagatttgatcgaccgaattgttgctagaaatctggataaacgagagatatggtttgtcatctcgttaggatttgagacgaccaatctggctatgatcgacagggccattagcgcgatgcctgcagatttgaccatcaagaatcagagtaagtcaataataactaagctgaaacgtcattcttttttgtgcagctacacttgtcgaaacgctcaaccgtgttgtcaatggcgcgttcgatcgttcattccgattccaagttatcgatacagtcatcaagacgtacttgaagtgcccatcgccggacatgtccaagatttgcgaggtatgatttatacaaatatcgaagtaaaattacaaaataaacattttcagtgttacgtgctcacggataacgccgaggccgctgctgacacgattacgagtttgatcgcgaagtctctcagcactcgtgcatatcagatcgcatttgatttatatgaaacagcgagtcaaggattcctcgatcgagttttgaaacgtttccaacagcaggatgctcgtgatgagaagtcgatggaaaagattcattcaattctcaaaggtcatgaaactgtcaaggcttacctcgacttctttgtccgtcataatcacactgattctgttctaatggaagagatcaaggagaacattcgaacagcctctgcccacaatgctcttctcatctcaaatggtcttatgcaatatggaactacttgtgacgatttcctccgtaacaacttgaactgggtttc