Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C24G7.4   

sjj_C24G7.4RNAiJA:C24G7.4
PCR_productsjj_C24G7.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC24G7.4 Source_evidenceePCR757WS150 Sequence/Annotation Release
Overlaps_Gene C24G7.4 Source_evidenceePCR884WS150 Sequence/Annotation Release
Chunk_score Abs_score821
Max_abs_score821C24G7.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI40970984098238
Overlaps_transcriptC24G7.4 Source_evidenceePCR884WS150 Sequence/Annotation Release
WB_DNA_textsjj_C24G7.41141tatggaatgccaaagcacaagctacacatcatacaactcctatggagatggctttaatcgtgggtctctcgaatggctcaagaagatcagcaataaatcggaaactcatatcaagaacaacgtggcagtcatcaatatcttctttttggaaatgttctacacatcgtattctcaggttcaagccacctcattaactgaaattctatcagacattggtggtaatatgggaatgtttttgggaatgtcagtgatcacaatcactgaactttctctattcttttcgaaaattttctggattatggtctcgaagcgaagaaggcagtacatgtactccaagaaaactcatgaaaaagaaaaagagcatcaattggatgaagcggttaaggagtttcaagagagaagatccagaagaaactcgagagaaaatatctcagcactcgggcactacagtaatcgaatcacgcctgttgatgattttcagactaagttcggatacaagaatgcgttttctgaagggaatatgtcgaattctagtttagatagtgtggtgagttatttttatttttatttttgttcaaaagttttgaaaaaaacttaaaatttcccacagtttctagaggtagaatggtgcagcttagaccgggttgttcatggtggtctacgcctgcgtaggcatgaagatattctgcacaccatgcatggttatctgcataaattaccatttataaaaatccaattagttgttcaaagatctgcctttttcaaaaaaaaacattaatatttttcattctccttattttccagatggagctgaaattcgacatcaacgagctgcgtcgtcaactgaaccagccttcaactgacggaatcgcccgtatccgccttccccaccaaacgagtcgacagaattctactgaaaactactattcatcctctccaccaatcttcacaattgagccaatgtctcgaaaacaatcgaaaacctctttaccatcatccttgtctcctcgttaattaattgtaaatagctttatgtacctatgtattatgtcagttggtaaccagatttagctggttgccttttaacttgttccccacacacttccatgatcattttttacgggttttcgcttcaaaacaa