Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25A1.12   

sjj_C25A1.12RNAiJA:C25A1.12
PCR_productsjj_C25A1.12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC25A1.12 Source_evidenceePCR848WS150 Sequence/Annotation Release
Overlaps_Gene C25A1.12 Source_evidenceePCR848WS150 Sequence/Annotation Release
Chunk_score Abs_score743
Max_abs_score743C25A1.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1019170710192809
Overlaps_transcriptC25A1.12 Source_evidenceePCR848WS150 Sequence/Annotation Release
WB_DNA_textsjj_C25A1.121103taaacgaaacgcctacgtttttatcaattccattgaatctgaaattatttttaaactatatttcgagtactcatcagccgaaaccttttgatcattggtctttttgcccaaccgactggcaatgtcatattcatgaaagcagtttctccagttggattgggaagattcagataatacacatatttgtaaatatcatagtcatgaagtccggggaatcggagtaaaagatctggacgcaactttttgacaattgccggcgctgaaaaaaaatcttttaagttaaataattaagattgaacagctaaccatatggccccatccatcgcatcggcgagaatggattgaagtatccggcaactcctccaaggaaggacatccaagcataaggtttaatctgaagccatgtattctgattattagcatcagaagctcttaaacaatacattcttaccagtttctcagttgtttcaactttttcagcgaatccccatggatctactagaatcagatgagcaactcttgatggattctcgagagcataagcactcgccaaatatcctccaaatgcgtgtcctataatgtacattttctcaattcccatggcttttcgccagtcttccatcacttcaaccatttccaactcggcgatggcattgtcgtcactgaacctcgatcgcgatgatcttccgaaacctagtggatcaaatgaatgcacagcatgatttttggcgcagctgttgaaatttgccgtgaacattgcaacaccagcgcccaatccaggaatgaaaactattgcttcgccgtttaggttttcagcttctctgggcctcactgtcaccgtgtacacttcgcctcttttgaatctgacctgaaaaagacactccagaccagagaaacaaatatttctcactcaccgggacatatttggcttcgtatgatacttcgcaagactgaaacagacgtccctcgacaatttttagttgttccttcgagtcatccgtgaatgtcatccaattcattctgaaaaccgtagttttatttgaacagcaagcatcaaatattaataaatacttacattgttgttaatgcagtttttgtcgttg