Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C25A1.5   

sjj_C25A1.5 RNAi JA:C25A1.5
PF:GL1_5C11
PCR_productsjj_C25A1.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC25A1.5 Source_evidenceePCR785WS150 Sequence/Annotation Release
Overlaps_Gene C25A1.5 Source_evidenceePCR785WS150 Sequence/Annotation Release
Chunk_score Abs_score695
Max_abs_score695C25A1.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1017733610178503
Overlaps_transcriptC25A1.5 Source_evidenceePCR785WS150 Sequence/Annotation Release
WB_DNA_textsjj_C25A1.51168aatcgtttggctggagaagaaattggagaatttatcagaggagaaaaaaggataatgggtgtacgtcatgagcactcggaagccgcttataatatgctcgagagatataatgtgaatgcaattcaaaaagttcgttccttccatcaaatctaattattaatatttctaaaattctagggtgatccattgattgagtctaaatccggaatgcttttcaaagttggatctcttggctctgaatattggcattggattcatcaaccatatgatggaactttaaggtattgatgatctcgacttttcaatgcaaattttcactttttttcagacttttcgattcggatgtgttggaaagcatgacaagaacagcttggtgggtggtccctgctgtttggatgccgatcgtcattactttttctatcctctcagtgctctcattttcaacatccaccgatgtttataactcgattctcctgtggtctgcctggttcgtcattggagttttgacatggactctcactgaatacagtcttcatcgatgggttttccattggaagccgtctccagattcgccgaatcagattcttcttcatttcttggctcatggacttcaccataaaacaccgatggacggagaccgccttgtgttccctccggttccagctactttgattgttggaattttctatttaatctactccaataccttccaatggtcagtattaaacctttcctggttcccatattcagttaatcgttttaggccagtgttttgcgcgtttggcgctggaaagttatttggatatgtaacctacgatatggtacactattatttacatcacggaagtcctcgtccacgcagcaatttacattttagaaaagtatatcatcataatcaccacttcaaaaactttgacgtcggtaagttacatttaacgggattttgtttaaaaatcaatttttaatttgttatttttaagtcaagaacattaaaaactgttttttaattgagattttctataatctgcaaattgtcgtgaaatataatgttctctgacggaaaattacacagatttgcgatggagcgcgtttgcactttcattttcgcaatcgaaatttttctatcattttccctatttcaggcctattttcatttttcaggcttcgg