Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C26C6.5   

sjj_C26C6.5 RNAi JA:C26C6.5
Simmer:C26C6.5:Screen_A
Simmer:C26C6.5:Screen_B
PCR_productsjj_C26C6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C26C6.5a Source_evidenceePCR1066WS150 Sequence/Annotation Release
C26C6.5b Source_evidenceePCR1066WS150 Sequence/Annotation Release
Overlaps_Gene C26C6.5 Source_evidenceePCR1066WS150 Sequence/Annotation Release
Chunk_score Abs_score1024
Max_abs_score1024C26C6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI75397987541415
Overlaps_transcript C26C6.5b Source_evidenceePCR1066WS150 Sequence/Annotation Release
C26C6.5a Source_evidenceePCR1066WS150 Sequence/Annotation Release
WB_DNA_textsjj_C26C6.51618taaagcgttcgtttttcgcttttgatcaaaaccaaaaatctaaaaattttcaaacgttggtaatttttcctgttttataaaaaagtaaatcaaaataaacaaattgttgaaattgtctgttaattttctcaacaatttttccgaatatttctgaaaaagtctccacattttttcgacgacacccgtgatcacaatgtgttttaacaaatcatagtttgaaaaaaaactcacgtctcattagatctatctttgagaacatgctgaaccactagatccaatccatgcaatgccaggaatgcagaagcattcggattcggtaggaaagtgatatcatgaggttgacttttttgtgttggaattgttgtcaattgcttatcagcttgagctctgaaagccagccgagctgcttgtatcctttgtgcaggtgtctgttgatttagaagttttgattgtgtgatttgagcctgttgtggttgctgtgcttgttgagattgttgtactgcaggtgatgcagatgcagaagcatttgtttcagcagcagaaagctctttttgcttttgaagattttgattattgattgtaatcagttgttggaatagttgagtcgtttgtgctggattcttctttgccataatgtatgcttgtttggcagctggtgattgagatgatagtttttgaagtaattcgagttgttgtggaattgaaagattcttaagtccattcattgttttgttatttgactcaatcatcgaattctttccattagtaacagattttccatttgtagcaaccgctggtttatatgctgcagatgtcgcttcagcaagatcagcagctttagtttcggcggccagctggaaaaaatattaatacaaaaaagttttgatcatttatttttatttcatacagatttcagtttcacaaagagtttccttcacttttgtcggtttttttgaaaatgtgtgttttttgaatgaaacattttatcagcataaaacttgaagcatttcctattctcagatcataactcgccgaaaatttaactacaattctctcagggcaaaaatccggaatttttgcgagttttatgatgaaaatttttttaaactatttgtgaagttacacttttatctaaaattggcgtttttatttctcgaatagtgaagaaaacgaaccttggtgatagctcttgtctgactatccttcatttttctcaaaactagcaattttgcctcttcttctcgtaactgattttcagcttctcttctcatatttaaacgttctcttaattgttcctcatccggttccttattcttcattttttcataatgatacctcacaacttccatttcactttcatgaattgaagaattttcactctcatcagtcattgcgtatacttcaccttcattattcgcacgaagtccaaatcggaaacatgtttgatcaaactcttttccattttcgagtcttcttttttttggagctgattgctcattaatttcatctcccaactcttcatcttccatatcatcatcatcattcgcccgtttttgtggtccttgtacaatatcatctttcagtttaatcttttcctgagccttcagagcacttgctc