Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C26C6.7   

sjj_C26C6.7RNAiJA:C26C6.7
PCR_productsjj_C26C6.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC26C6.7 Source_evidenceePCR841WS150 Sequence/Annotation Release
Overlaps_Gene C26C6.7 Source_evidenceePCR841WS150 Sequence/Annotation Release
Chunk_score Abs_score736
Max_abs_score736C26C6.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI75106467512329
Overlaps_transcriptC26C6.7 Source_evidenceePCR841WS150 Sequence/Annotation Release
WB_DNA_textsjj_C26C6.71684tgccacttgtccaaaattcactttaaagttttttataaaaaactttgattttaggactctcaaatctctacttttcagcaaaaccacgcccaatccaactccacgaaccgttagaaaacagcttcgattcgacattccagaggtagagactccacccatttatttctctgcgtttccaatcattaaatctctcttcacttctaggtgcacatttcatttgagacgaacgagcctcgaaaagtgacttttgaaggtggctcaacttctaattcaattgtacctccaccgattatcgactgggattcgacgccaaaaatgaattcagtaccagaaattgaaccaattttatgctttgatgatgaagtttctgtgaccactcgaagactttcagcaaatgaaaaagcacgacaaaatgtgatagctcaaagaaggcagagtaatgttcaggtaattattattttttggcaataaaatgaaaatacgagtttcagttagtacaatcaatgagtggacgaacaacaacaacgactttaattccattaacatgtgctcaaattcatttggttagagcattatggagacaagtttatacaacaaaaggaccaacagtgattggagcaagtatatatcatcgattatgttttaagaatgtgatggtatgttttatgtatagaatctatcttttaaaagtagcgagatttttaaaaataatttttatgaactcaaagtaaccaaacggccaaatttcataatgagattccacggattaaactaccaaaataaggaacattgagtgaaaattaaaggttaaacactctaaaattctatataaacacttcggtgaaccaaagattaaaaaaatggtgttctttccggaatttcaatttttttgtgatttgaatattaaatcctaaaaaatattgctgaaaactaaatttgcgccactttccgatttaaaacactccaataaaaaattttaaacgttttattatgatagttccgactactgcgacacgaaatgtctcttaaaatttcgctgaaaatattgaattaccgagcatttttcattcctcttgagcacaaagttttaaatattaagtattttcgtgtatttgatttacaggtaaaagaacaaatgaaacaagtcgagctgccgccgaaattccaaaatcgtgacaattttatcaaagctcattgcaaagcagtagctgaattaatagatcaagttgttgagaatctggatcatttggataatgttacgggtgaattgatgagaattggaagggtacatgcaaaagtgctacgtggagaattaactgggaaattatggaatacggtagctgaaactatcattgattgtacactggaatggggtgacaggaggtttgtttgttttttttttgcatgatttgaaactcagaggaatttggtaatgatcaaagaatgtttgatattctgtcataattccaatgtgttttgatatatgtctcttggcaaatcttacattctcgtagaatgtatgtagttgataaaatcaaaaaaaaagtagaattcgaaataatttatgtgaaatctcaatatttaaaggtgtcgaagtgaaacagtacggaaggcttgggcactgattgttgcatttgttatcgaaaaaatcaaggcaggacatcatgagcaggtgatttttggg