Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C26C6.8   

sjj_C26C6.8RNAiJA:C26C6.8
PCR_productsjj_C26C6.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC26C6.8 Source_evidenceePCR598WS150 Sequence/Annotation Release
Overlaps_Gene C26C6.8 Source_evidenceePCR598WS150 Sequence/Annotation Release
Chunk_score Abs_score514
Max_abs_score514C26C6.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI75036607505353
Overlaps_transcriptC26C6.8 Source_evidenceePCR598WS150 Sequence/Annotation Release
WB_DNA_textsjj_C26C6.81694ctggtcttccagtgcattttatccattcacctggtcggactgttagatcaagaggtgatcttccagaaaaaggttcgactacgagaagattttcattttccctaaaaattaaataaatttgccaagccaaaatataatcagtttatttcgcaatcttttgaaacgcaagcacgagaaaaacatttatggcagtagttttttatcttgcaacggcccttttgcttttttcgggaatttcgtgaacaattttaaagtcgattcttttgattttttattacccatacgcgaaactttgcaatttttgcgccaaaaatatggtactcaatctcgacacgacaatattttttatcaaatgtaaacggatgtgcgcctttaaagggtactgtagcttcaaactttcgttgttgaggaatttgcatagatttttcataattctccgttaaaaaatgtatttatttattttaaaaaaccacaaaacacatatattttattttactaatcgtgagaaaaactatgagcacgaaaagttgtatttacattacagtagtctttaaaggcgcacacgttttcacacttaacaaaattgttatcgtgtcgagaccgggtactgtatttttggcgcaaaaataacaaattttcgcgtcttctgagtcttttaattctgaaaaaaaaaacagaataacacccatgacccatctgaataagtccgtacacctttaagcgtttcagaaaactgcgaacttacgataccatttttctttaatgacacggctagcttgttgcaatatttcatgtggaatcttaacatgggaagaaggtacaaaaccagattgattgtccgaatttcgaatataggtccactcaggatctgatatattcaaaactgtgacagattctccatctttcacagatatatcatctggagctgatccatcaaatgactgtagtatttgaacttcgcatatctcatcctgcagatagtatcaaaagaatattcaatagctttattcaaaacaaaccattttaaaaacctctccttcttctttttgaacaggaagactgtcgataaatctctgcaaatttgatttttcccaacggcgatcaagtgtcgcgctggatccgatcacctttttctgaaaagtatttgatttgatttctcaacggttccattcccgaaattcttggagatcaaaccgaaatgggactctctgacatcacgtggcttctaagttgttctcactaaaggtgacaatgattttcaccacttttcttcgatttttcaatgacaaaactatgaaatatctatgaaatattggaaataattaggagtgtggttacagtaattcgcaaggcgcacattcttttgcgcatatttcggtcgtgtcgagaccggatacagtagttttaaatgaatatcattaaatgccacaattacacgtgttgttgcattctttaagatttgcactaaaaataacttttctagaacatctaaaacgctcaccttttcaccgtgttttgaattcaaaagcaatttacaatatgtctgtggaacaaatccttttcttccatcagatacctcaacataaatccattgatcatctcgataaattgctttaactgtagtgccacgggttacactaatttcgtcagcaaccttaaaagtgagaggttagaaattggggtaatttggaaaa