Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C26E6.8   

sjj_C26E6.8 RNAi JA:C26E6.8
Simmer:C26E6.8
PF:GL1_5D2
PCR_productsjj_C26E6.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C26E6.8 Source_evidenceePCR932WS150 Sequence/Annotation Release
Chunk_score Abs_score806
Max_abs_score806C26E6.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII49190604920237
Overlaps_transcript C26E6.8.1 Source_evidenceePCR932WS150 Sequence/Annotation Release
C26E6.8.2 Source_evidenceePCR932WS150 Sequence/Annotation Release
WB_DNA_textsjj_C26E6.81178aagagttccacgaagaggcagaagattattattctcggtgacaaaacgacgaagagcttcacagattaaccagaatgggcgtgtcgatgttgaacattgtggagaagagagaatcgattttacagaagaaccaatctgaaacttactagaaatgagaatcaatttggataatttatcaaaaacttaccgtagttctttgaaaagctcgaataaccgccgctttcgcctcatcaaaattctcagaatccttggttccggattcttcactcgaacgtcggaaactcataagaatcgcctgaagttctttacgttccgcagttgtagatgggaacgcttcaggatcatttcgttgctttctgaatacttcgagagctgaaattaagaaggtaaataacagaatacaaccataattgcgagaaaaacctttgaagtgaagaagaatatacggagtatggcggagttgttctagagtcatttcatctagatttgtttcattgatcatttcaataagctttgaaaatggagcatccaatctgagaaataaaaacttttttggaagttttcatgtatattttaccgtaaatcaggtctcggattctcttcgtgtgagttagcaattgtgtgttctttgatgcagattcgaatggtaccaattagtccaaaagttctgaattttggaattttaactgcaagaacttcaaattttgaaaatatcgtacttgatacagatgaatggaactctaatattatacaaaactttcgcgaacgtcgtatcaatttcttcattttgatttgcagcaacaaccacagaaaacgttgtcagcttttccacatcttccatagctaacgctgttggtggctgactacttgcactaccagagactgatggattcagttcggtaagcttctccaatgttgcctcggcacgagaacgtccaatatcatctgcatggaggaagaaattctgaccgatgtcagcttgttcaactttggcgtcatcaacgacatagaatgattgaacaccggcgagaaccaacgatttcaatatttctgttgctaaaaatatttagattggatttttaattcaattttttcaaaaatacctagcgaatcgcttccaagaacacatgcacttgttgaaccaattgatgcttgtccttcttctccccaaagtcgaa