Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C27A12.8   

sjj_C27A12.8RNAiJA:C27A12.8
PCR_productsjj_C27A12.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C27A12.8 Source_evidenceePCR921WS150 Sequence/Annotation Release
Chunk_score Abs_score837
Max_abs_score837C27A12.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI60594426060641
Overlaps_transcript C27A12.8.1 Source_evidenceePCR921WS150 Sequence/Annotation Release
C27A12.8.2 Source_evidenceePCR921WS150 Sequence/Annotation Release
WB_DNA_textsjj_C27A12.81200gagcatcccgagcatttttagctgcagaatcatcaaatctattacaactataccatgatgaaccatgaggttcccatggaccaaggcacatccaacaaaattcgaaccggcatgctgtatttttacacgtcatatgattgcatccaccgtctttttcaattgtgatcatacattttggacattctttagtgtttgcattaatccaattcgatgtttcactatcatcattgcactttttaagccataacttcagcagcctacagttcactggttcatgccaatcgtgaccacaagagaagcagaatcgagatccacaggagcatacgacgaggcggggttcccaatggctgacctgcaaatttgattgaaatcattttttaactgaaaattcactcactctaacagctttcccacaatctataccggggcaccacttgagaagacgattcgtttccacataactagccacaatcagctttctgtaggtggcaattactgttgggtcggtaatgtagaacataacctgaaaattaaactattttgaatttaaatttaactttggaaagctatcattttatggtaatttttaaaatttgttttactaatactgctgattttcactgtatttgaaaaattaccaattttctatttagaaaaaaggtttcttccttttatatcgtattcatcaatactgattttgacagctctcctcaccttttcatcttctatgagcaatttgcaatttggagccatacattctatttcggattgtgcattgtttgcaatcttattagttaaatacgccttccagcattgtgtacaagctctgtgattacaagaaagcccagagagttctcccaacgagcaacatatgtcgcattccgcgtctccagccggcaaacgctcctggcgacgtggaataacatgagcatcgataagaaatgtggtagtgtcaggatgttcgtagaatcgttctaataatgattccttattccatttatacttgtgcagaagaatccgacagacaccagttttcacttgaagaactgcttgtacatctgttattgtctttttcatctctgcttccaaggaatcgtggtttagcacctgaaattttgaatattttaaatgaaaatcgtaggtttaaaacctcattatccggttccccgttatctttgtagtcggagctattctgttcgc