Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C27F2.7   

sjj_C27F2.7 RNAi (3)
PCR_productsjj_C27F2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC27F2.10 Source_evidenceePCR851WS150 Sequence/Annotation Release
Overlaps_Gene C27F2.10 Source_evidenceePCR851WS150 Sequence/Annotation Release
Chunk_score Abs_score725
Max_abs_score725C27F2.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII49853754986498
Overlaps_transcriptC27F2.10 Source_evidenceePCR851WS150 Sequence/Annotation Release
WB_DNA_textsjj_C27F2.71124tcagtgactccaacaaagcgaagagcagtttgaaaagcatccaaaggaatttgagcagttccgactatctgacttctaaacagaaaaaaattatcaataaacatgaaaccttaatttaactcttacacttttttgaaaagagttcggaacgtgatcattcgcagcttttcaagcatcagaaagattccacacttgatgaaaaatgcttcgttagctgcaagagctccatcgagttgagccaaatttccatctgaaaacgtttcatgttcaaatgttgttttttttaagttgaaaccttttacaccagccacaacatcttgaaactcatcaagtcgatactcatggagaagctgggatgttggcatgtgaccaagaaacattttcacaggaattaaataaatcagaatctttcgcttgttcgacatactgtcagctgggcagttcctgaatgcgtagagcagagatttctcggctgaaaaaaatgtattgaactcaagatttcagattttaaagaaaaccatacccagattcaaatcggcatcaaacattgcttttctaccaaggaaatagttgtaagctactttatccgacatcaaaaaatcatgatacaatgacccacaattatcgattgcccggatcaatggcttcaggagattcagcttatttatctaaaaattataattacaattcaaaaaaattgaagaaagcatcaaacacctgaaaataaatttggaatagctgatttgtcatattcaacattgccactttcttcgtggttccctcttcggcatgaacatccgaaacacaagttctgtagcattctgtgatcgctttggcggcactttcaaaaaatgaattcgcatttgaatctccttcatcatcaccagacacgcatgcttctgcgcctttactgagccatctcaaatcagtgcacaatcgatagaaaattggaagaaaccagttttcgtcttttcgcttttgaagaatctctttgttgaatagttgaataatctgcaaagacagctcttttgaaagcctttttcgacttttttttccaaattctatatttcaaaaaacaatgaaattacctgaatctgtgtcgactgagccgtgatgagatcttg