Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C28A5.1   

sjj_C28A5.1RNAiJA:C28A5.1
PCR_productsjj_C28A5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC28A5.1 Source_evidenceePCR1045WS150 Sequence/Annotation Release
Overlaps_Gene C28A5.1 Source_evidenceePCR1045WS150 Sequence/Annotation Release
Chunk_score Abs_score961
Max_abs_score961C28A5.1
Specificity_index0.534
Rel_score1
Map_statusUnique_ePCRIII44310914432233
C28A5.2 Chunk_score Abs_score837
Specificity_index0.466
Rel_score0.871
Overlaps_transcriptC28A5.1 Source_evidenceePCR1045WS150 Sequence/Annotation Release
WB_DNA_textsjj_C28A5.11143tttctcccaactggaacgactttggcaaattattgaactttcctctgaaattctttggcattagtttggcacatttaaggttgaaaatacccgatcggaacgacgatagacatgtttctgaggttaatatcaacaccaacaccaagagcaacgaaacgtacgagtcctttgatgcaagtctcatcaaacgatggtggaaatttaatgctttcgacggcgattactgtaactgaaagtttcgttgttcgtgtcacttgcgccagcggtaaacgattccagcatttgagaatggcatttttattctgttcaacaaacatttttcgattgtttctgaaaatatgaataatcaagacacgaaaatttataacgattttgaacttacatattattatagataatatctctcagtagcacattatgcggcgtgatattcctgatctgcctgaatccatatggagcacgacgttttgggcgtccgtttaatgatccactggaactcgagccataactgtttctcggtcttactctatcaccgggagtactgtatccgaatattcgacgtcttggtggaggtgaataatcaggacgaccaatgctaattttatcaacatctgaagctagtctgtccacagttgatgcacgactagaagcttgatcatgagtggattcgtagaaagactcagttatgatctcaggagtatccatagttgtttctgaatgctgatttgtcgaatcaagccaggattcggagatgagaatattggagtcatcatttaacgcagaaaatctcgcgtcgtttctgtcgatgactgtacaagttgaagcagcactggatgattcataaactgattccgttaaaatgaaatctccggaagttgaagcactatccgcgatactttgattgtcgaacaagagctgtctttcgaatgatgactcgttcagaattgttggatattctccggtgtcgggcagattgtgatccaaactgatggaatcgttaattaagacaatgttattatcagcagctgataattgaccgtttggattggttcttgccaaagctccggaaacttcgtaagacaaattgagacttctggatgggtaattcgtcgttctcggatgctcacgaacagttgaagccag