Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C28H8.11   

sjj_C28H8.11 RNAi JA:C28H8.11
Simmer:C28H8.11:Repeat_a
Simmer:C28H8.11:Screen
PCR_productsjj_C28H8.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC28H8.11a Source_evidenceePCR753WS150 Sequence/Annotation Release
Overlaps_Gene C28H8.11 Source_evidenceePCR753WS150 Sequence/Annotation Release
Chunk_score Abs_score567
Max_abs_score567C28H8.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII59181995919663
Overlaps_transcript C28H8.11b.1 Source_evidenceePCR606WS150 Sequence/Annotation Release
C28H8.11a Source_evidenceePCR753WS150 Sequence/Annotation Release
C28H8.11b.2 Source_evidenceePCR606WS150 Sequence/Annotation Release
WB_DNA_textsjj_C28H8.111465gtagatcatcatggctccttttgtagcatcatgggagagaagacgatttcctggaagattaaccagggtgagatggtgtatagcttaacacgattatcagtattgtaatttagatatttccaacgttttagatttattggattattgtacatgtgtgtgcagctgacacaactgacgcgaaaagctcaatgtcttccattttcagggaaatgtatgattcataatttatacccaccatttctaatatgttgttcatgttgccttgggtccaagattgactggaaagcatccgcagttttatgatattcggccgtcagttgcttggcaatctcctccgtgtttgatgggtccttcaacaatacgaatttagccttttttttgaagaaaaaaaggcaagttgcctttggaaacaaaaaagaacgaggcatacggaaaaacgtttcgagaaataatggggttactcaaagattgaagtgaaaaaaagaacaaaaaagatggaacaactacgcaacttatacactggtgatacttcaccattaatgcaatggccaggagtttttaagtaaaaaaacgaaccgctgcttgtttcgccaaatcagcaagatacttattaacagatttctcgtacttgatccagaatccctcatcttctgaagttgatttcaatcctggtgttctttccaaccaactttcaatcaatgtcaaaagactcttctcttcttcggtcacattcaatgttttgaggtctgtgtcgttgaaaacattcttgtaatgttgagcgttgtactgaaaatttgaagaatactcgaagtttatatttcaacattttgatgtaaatgatttccgcgcagagaaggtcgccttctaggcaagcaggttttgtaagcctacataacgaattagtgtcatttaaatcttctaaccttaattctacgctcctgtcgaacaccgagcttattctccaatacacggaactgaagactctggaatcccgaagctggtgtcaaatactttctgaaatccacaaaatccaatggactcattgtgtcgagcaaagtgatttgctcggtgagcaagcttagtatttttgtcattctatccaaaccagaaacgatttttaaggttttcgtctcgtcgacaatctggaaattgcagtttataaatagttaatcattcttttgaaaatcagaactgttggctaaaaatttacacacgaaatatggtggattttcccaactggatatctcagacttacagtgttattgagaagttttctgacattgtccaaatcaaaaataatctgcttgaaccagagctcgtgagcctggtggatcacaataaagagatgttcatcgtctacacgttgaccatcggcttctgatttcaatctttgtgctgtgaggattttgtccaactgaaaatttactttattgggaacattggaaaagctaattttggcaggttt