Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C29H12.1   

sjj_C29H12.1 RNAi JA:C29H12.1
Simmer:C29H12.1:Repeat_a
Simmer:C29H12.1:Screen
PCR_productsjj_C29H12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC29H12.1 Source_evidenceePCR962WS150 Sequence/Annotation Release
Overlaps_Gene C29H12.1 Source_evidenceePCR977WS150 Sequence/Annotation Release
Chunk_score Abs_score893
Max_abs_score893C29H12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII61265786127687
Overlaps_transcriptC29H12.1 Source_evidenceePCR977WS150 Sequence/Annotation Release
WB_DNA_textsjj_C29H12.11110caagtcaagtccgaaaagcccatcaatatgctcaggaattaattgataaaggtttcactgaagatttggatggtaaaacaatattcagattacgagatatcgacactgagaagaaacaatcagacggagtgaactatgcagttttaagaaaaagtgacatgtcaagtttgtatctaacacgagaaatcgctgcgatactggaccgagatgccatgtttcaagctgatcgatacttgtatgttgtggatcgtgctcaacgacaacatttcaaagctctgaaagttattctggaaaagattggaagatctgatttggcttcgaaaattgagcatattcaatatggcagagtcagaggattatcgacgagaaatggtagaacagaagctgttggagaaattattgaaaagggaagagaacttgctttgcagtttatgaagtcttcgaaaacattttgcatggatccagcagttgaatcagatgtaagattaaaatttaaaaaaatttccaaaaattccgatttacagattgcgaacgtcttatcactttcaacggtagtgttcaatgaattaaaacgagcacgaaattcggaatatgaattttcatttcaaaatgcgtttgctctgaaccaaaacaatgctctggcccttcaggtatttcaattttcactttcagtattaaaatttatttttttctagatgaagcacagccgattgtcatctattgaagagaagcaccaacacctatttcctcaaattgaagcatgcacaaaattcaatgattttgatacgaatgatgatgtaaaaagattgattcgattgttgaacgacttggaaaaggcagtggagttgagtgcagagaaattggaagcatgccaattaactgtgcaactgattcatgtggcagccgcagctggaagcgttcagaaacaattacgagttaaagatcaaccagatgaggtatgtatatagttattatgaaagtttcatatttttatttcaggttgcagtccctcgtttactgctattctctgctgttcggaacgttcttgctgaaggccttcgctttctaggaatcaccccagcccgttcaatgtgatggtacgacctggaa