Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C30C11.2   

sjj_C30C11.2 RNAi JA:C30C11.2
Simmer:C30C11.2
PF:GL1_6E9
PCR_productsjj_C30C11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C30C11.2 Source_evidenceePCR890WS150 Sequence/Annotation Release
Chunk_score Abs_score848
Max_abs_score848C30C11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII84481088449044
Overlaps_transcript C30C11.2.2 Source_evidenceePCR767WS150 Sequence/Annotation Release
C30C11.2.1 Source_evidenceePCR890WS150 Sequence/Annotation Release
WB_DNA_textsjj_C30C11.2937acaatgatcttgcccgctacatgtactatcaaggacgtataaaggctcttcaactcgattacaattcggcggctggatatttcttgcaagctcagcgaaaagctccacaagaaggtgccattggcttcaaacaagctgttcagaagtgggttgttgtcattggtcttctacaaggagagattcctgatcgaagtgtgttccgtcaaccaatttatcgcaaatgtcttgctcactacctggatctcagtcgaggcgttcgcgatggagatgttgctcgttttaatcataatttggagcaattcaaaacacagtttgaagctgatgatactctcacattgattgttcgtctgcgtcaaaacgtcatcaagactgcaatcaagcaaatttctttggcgtattcccgaatttatatcaaggatattgccaagaagttgtatattactaacgagacagagactgaatacattgtaagtaatttatattgacagttttatgtttattataattgttgcaggtggcgaaggctattgccgatggagcaatcgatgctgttatcacttctgatgttcgtgatggacctcggtacatgcaaagttcagaaacagctgatatttatcgtacttcggagccacaagctcacttcgatactcgtatccgttactgcctcgaattgcacaatcaagctgtcaaagctctcagatatccaccaaagaagaagatcgctgttgaaactattgagcaagctcgtgaacgcgagcagcaagagttggaattcgccaaagagctggctgacgaagatgatgacgatttttaaaccgatcactcacttttttaatttattctgaacaatgcattggaacgtgtctgtctccgtaaataattttgtgtgtattttatttgaattttctcgtctcttttcaaatcgagatccctgtcc