Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C30F12.5   

sjj_C30F12.5RNAiJA:C30F12.5
PCR_productsjj_C30F12.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC30F12.5 Source_evidenceePCR771WS150 Sequence/Annotation Release
Overlaps_Gene C30F12.5 Source_evidenceePCR771WS150 Sequence/Annotation Release
Chunk_score Abs_score607
Max_abs_score607C30F12.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69921966994492
Overlaps_transcriptC30F12.5 Source_evidenceePCR771WS150 Sequence/Annotation Release
WB_DNA_textsjj_C30F12.52297cgaaaattgtgagaaattttggaatctcccattatttctcacacagaatataaagttggatggctgaaagatctaaaaaaatatatgtaaaattttgagaaattaaaatattttgttaatagataagttcttcacgtgtctgcgtctcttgtttccttcgtggatccaagaagtgtgggtcatttccagatgaatatgatggagataatggaggtggaggtgctccattcggagcaagacgagcacgtggaactgtaaataatagtataatggaaaataaaatttcagaaaactaaaaatgaaatattttttattaaacagaaaatgtgtcaaatgggttttgatttaaaattattcagtttttccttacttttaaggtttttactgaaagtttccagaaagcttccctcttaaggaacaatgctactagaagaagaagaagctagaagtgaaaaatgcattcattgttttgttacattttttttcaacgtgaaaagaaactcaaaacattattgcggaattctcaagggtttccactttttttacaaaataagttgtatattttgctgatggatattattttttgatatttccaaaacatgtttaaaaataaactaactagttccataagtcgggtcaattggtggaagtggtgaatatagaggatgtcctattctcggttcatcaattggtagttgtcccattgaaccattttcataatctttctgtccttttctatttgtgtcaactcgatatctgtatgttgagtttggagtatgtggtacggttgttcctggtggtggtgggtatggtagaggacttccagagtatggggttgagtagattgcatcgtggtgacgtggattcaacgtgctggaatagaattattatcgggctggtaagtttgtaggttaaccaagaccaaagttttagtcagtaaatcgtcaaaaaccttacacaaatccgcctttcactacttggagatctgctttatacaagtggagcaagctaggaaacatggatgtaaaagaaaattatttgaacaagaggaaaacaagtattgacttcaaaaaccgaaaaaaatttaaaaaaataaaagaaatccaaaattgttttttggttttaacgttaggaaattaatgacatcatggacttgtgttgttgaaaaaggaattcaattccggacgaccagggaaacagtcatttttaggttacaccgtaaattcgcatccctaataccgagcaaatttttaatttgaaacttacgaaggtggagtgataacgtagagaggctcaatagacttgtaagttgctggtttcgtaacttcgtacttttcctgaaaacaattgatatttgtcattcaaatttctctttgatcattggcgtctttcattttttcccgttaaaattgatcgtttgaaaagtgacaggatatcaaaaaagaacaagaaggtcttttttaatgtgacgccccaaatccctcttttatttcatgtctaataaatacccaatccacagagacaccttcctacacatacatttgacccacaaccaataagaaacagtttgattggcttgggaaaattgtaattaagtggaagagaagatttgacggagaaaaggtgttaatggaaggttttatgatatacagagttttaggattacataatattaatatagcaggaacaatgttaaaagtattcattttagcttttagagttcctatgttttaggttttgacaatatctaacggcgatagttttgctttcagaagatttgaaaccaacttactttcttatttttacgacaacagcagaaacatttggcacagatcattgagagaagaattgaaacaagacaaagcacaaggagcacagcaacaataagtccaatcactggctgaaaatgcacattacagttacaagcaaaaagaataatcaaaaactcacaagccacgatgcataccaattgtcaattggggcctctgaaacttgcttgtagtttgccaaaagatattgaactgctaaagtgtcactttcacttccttgctgaaaaaaagaaaattcaatcagttttaaattgaaaagttctcacctgtgctgctaacttgtgtagtttctgcatatcgtcatctccaagaagtacaaacgaatcaccgccacggtatgtagccaactgaaatgtgatattattttatgaatttagtgacaaaccttaggaactttttgagaaaaatctggcaacttgttaaaaaacttcacaaaagttgtcagagaactgcaatatttgccaaaaa