Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C30H7.2   

sjj_C30H7.2RNAiJA:C30H7.2
PCR_productsjj_C30H7.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C30H7.2 Source_evidenceePCR751WS150 Sequence/Annotation Release
Chunk_score Abs_score628
Max_abs_score628C30H7.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI54179335419524
Overlaps_transcript C30H7.2.3 Source_evidenceePCR751WS150 Sequence/Annotation Release
C30H7.2.4 Source_evidenceePCR751WS150 Sequence/Annotation Release
C30H7.2.2 Source_evidenceePCR751WS150 Sequence/Annotation Release
C30H7.2.1 Source_evidenceePCR751WS150 Sequence/Annotation Release
WB_DNA_textsjj_C30H7.21592gacacttaccactggatctggaccatggtggaattcgcgatgaagctttccgctgtgcagatcgagcacgaattcgcggagttttccggggacgctgaaataattttgtttgtttatataatccattttccagatcttacttgacatcttcgaaattcttgaataaatacatatgtcggaaagaatcaattgcaatgactggaagatcggattccgatttacccaagtgactgagtggatgcttgaagattgttccatcaccgaccaagcagttaattgctgaaattattcattttaaaatctaaaaaaactcgaataaaataccttttctctgatcaggaagttctcgaacaattgcatcagtgaagatcttctcactgactttatcatcagatttcttgaaaagaatcataaatggaagtccttcttcagtcaattcttctgcattttggaatgtgatttcacgaactaatggcacacatttgtcagcaacccattgtctgaaaatttaattttacaataattattttttttacagtctcctcggctcgaaattggttccttgcccctttttaaattttatcgagtttttttttgtcgaaaattggttaacctttgttttttcttaacaaaaaaaaagttttaatattttgaaacatgagatattttttaaagatatttttttgtatttttaaaaaagatttgtgaagaaattaaattatttttaacccaaaaaaccgaacagaaaatgtttttttttggtgatagctcttttttagaacgcgtgggaatttaagaaatcaccgaaaaagcttaaatttgggttttttcttcagcttttcattttttcaggttcaatgtgagaatatttttcaagtaagacaaactaccattgcgatgagaaaaactaaatttttcataacttttactaacttgagatattcataagtggcaaaatctccagagaatggaatctgtgctggattcacagccttattagatggctggaaaacgagtttcggtggttgaccagcagccggtgcctctccagggaagttcaaatctccgattccaaccataaattcacattcatcacgataaaacattgccacgttcatgagattcttgtactcgacactgttttcatcatggaaatatccaataaatgtgttcttttctggctgaaaaatatacttttttagttttgaaaccttctttttgccacaatagaaaatttattttggtttttcaaatattttcagtgaaactcacattatgcgcagcttgaagtgcatttttctcaataaacttcttcactgtaacttccatttgtttattgatgaattcgctaagagcctccacggatcgggaacttctgaaattcaaaatttaaaataatttttttgaaaaaaataagtgtatcgtcaataaaaaaagttgtgtaaaattgcagcctatagtgctaaaatgtcctaatatcatagtaaaacaaatttttgaaatatcttaatttttagtttcacatattataattttggaatttgaccaaaaaaaattttctcagagtgtagaggtgtagaggaggagaagga