Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C31A11.5   

sjj_C31A11.5RNAiJA:C31A11.5
PCR_productsjj_C31A11.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC31A11.5 Source_evidenceePCR829WS150 Sequence/Annotation Release
Overlaps_Gene C31A11.5 Source_evidenceePCR829WS150 Sequence/Annotation Release
Chunk_score Abs_score745
Max_abs_score745C31A11.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1630653416307714
Overlaps_transcriptC31A11.5 Source_evidenceePCR829WS150 Sequence/Annotation Release
WB_DNA_textsjj_C31A11.51181tgctgtgggttgttacaggacacacattttcttatttaacaactccaggtaaatcttgatttgacacacaagcatagctacgataaagtttcaaaaacttcaaatttcagaccaaatcgaatcgattctcccattcttcggtcgattctggaatcatcttgttatgaatgcattctactcagtggatacatttttcttattatcaggactcgttgtttcatatctctttttcaaaaccaaactcaaagtatctcaaatcaaaagcccaatcacatggatccttttctacgtgcatagatatctccgattgactcctccactaatgtttttccttggattctttgtggtttatggcaaatattttcaaggtcccggggtagcatcacaattgagtaagttcagaatattgtttttttttggctaactagtaaaaaattctagatcaacaaaatggcgaagtggatacttgtcaaacatactggtggaaaaatttgatctacattaacaatcttatgtcgggtgatacccagtgctacggaatcacatggtacctgggagcagacactcagctttacctagttgctccaattttccttatcgggctgtatttctcgtttgccattggaacagcactccttaccgcagctacaatcggaagtgttatcacagtatatattttgttcagcacctacgatctacctgcagactttttcggaaatgggtatgactggctttaatcgaaataaaaaaaaaacttattgatttttagtgatgcgacccacttctacgacatgatttatataaagccttggatcagatgtcccccatattttgtcgggatacttgtcgggtatttacttgcaacttatggaaaaaggaagcttcgattgaattgggcacttgcagtaactggatggattgtggctttttcattgggagcattgtgtatattctcaacttatgattacgataataaagttaaatggaggtaagactaagccttccgtgagggtaaaaaaaaggtagggcacgttgatacccttttttaccctttacccgaacagggacacattaccctatgtctccacgtaataatacgaattttaagtattattcactttatttgtcaaattttcgtttttagaaatgaaatttctatgaaaattgggcatagggtaggg