Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C31E10.7   

sjj_C31E10.7 RNAi (2)
PCR_productsjj_C31E10.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C31E10.7 Source_evidenceePCR462WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRX1400157614002898
Overlaps_transcript C31E10.7.1 Source_evidenceePCR462WS150 Sequence/Annotation Release
C31E10.7.2 Source_evidenceePCR459WS150 Sequence/Annotation Release
WB_DNA_textsjj_C31E10.71323actactccttttgcccaattctctcgtccatttcttctccgccgttattatttgtttgttcaaattgtctctctgctctctttcccatgtttctctatttctcctttcaacttggtcagctatttttctctcttcatccttgacacaattgctgctgtcttttctgtcttgtattgcaggcctgtattttaataacataatttaatatgttttttattgccatacttctcatatctatatattttttaataacacgaaatgattttcagaatggccgatcttaagcaaatcacccttaaggaaattgccgagcacaacacaaacaaatcagcatggcttgtaattggaaacaaggtgtttgatgtgaccaagttcttggacgaggtaagattatgttctgatatttagaaatccgtactcgaagcacgtaggcagacataaaccacactttacggtacgaataacacaaacgcagattcattgttgatcaatagaaagaaattgacatctatgaaaaatgaaaaggaattaaattttttctctgcaattgataggatttcttgctcaaaaatttttagcatcaactttatcaaaaatagccgttaccgtctctttcaaatatgtattcttattttatcgttaaaacaaaatttactgtttgatacaatcaaaaccatgacgattaagatatcgaaatacttgaaaacaaataggggcaaaaattcccgaattttttgtagatcaaaccgtaatgggacaggctggcaccacgtggcgcatcaaaactaaaaattaataatgtttttttttcagcatccgggaggttgcgaggtccttcttgagcaggctggaagtgatggaactgaggcattcgaggatgttgggcactccactgacgctaggcatatgaaggacgagtatttgatcggagaagtcgttgcagtaagtttttgccttttttgcttataattttcattcatttgttttgtgttccagtctgagagaaaaacctactcgtatgacaagaagcaatggaagtctaccaccgaacaggataacaagcagagaggagggtaagtagggttatacttttattttgaatttgaacttttttaaaaatgattttaaaagttaacttttgactaaacgctgcatctcagctcagaataataatattttttcagagagtcaatgcaaaccgacaacattgtttacttcgcccttcttgctgtcattgttgctcttgtttattatcttatcgctgcgtaatcactgttgatccactattttcgccatgattttgaaaactggggcattatctta