Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C32C4.1   

sjj_C32C4.1 RNAi (5)
PCR_productsjj_C32C4.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC32C4.1 Source_evidenceePCR770WS150 Sequence/Annotation Release
Overlaps_Gene C32C4.1 Source_evidenceePCR770WS150 Sequence/Annotation Release
Chunk_score Abs_score665
Max_abs_score665C32C4.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1064503810646087
Overlaps_transcriptC32C4.1 Source_evidenceePCR770WS150 Sequence/Annotation Release
WB_DNA_textsjj_C32C4.11050cgacgatcacacatgattccggtttgattttcattgaattcgtgggaacttttcttttatttcatggaaatatattgcagggtccaatgccgatacttacatgaggcttaatgttggtggaaaatcgtattacgttcgtgcggaactctatacatctgaatggacaagaatgcatgaattacttgattcaagtcacgaagaaaggttgttcaattaaaataaattgaattaattttgatttttttgttttaggttaaaaatggtggatgggtttgattctaaaaccggagagtactatctggaaagaaatgccaaattgactgaccatgttatggatttttttgtgacaggaagcttacataaaccacaaaatgtttgtgtcgaaagatttaaggaggaattagagtactggaagataaaaccagatcaggtgaggtatacttcaaaagcagtgagagaataagacgaaattaattcaagaacatgaaacaaaaaacaaaatcatttgtctaatattttgatcagaacaaagaggaaatacaattaatgttatttagctctcaacctgctgccaaatccccagtgagcatcatgttcgtaaactttcacgtggaacgtcattcaatgaagacgactatgtcacagatttcgatggagcgtgtttcgcaggaccacgtctcgcaatgtggaaattcttggaggatcctcaatcatctgtattcgctgccgtatttgctttgctatctgtgttttttgtttttgcatcagtcgttggtcttattcttggctcaatgccagagtttcaggcagactcgtctaatgcagcaacttatcatgttatgcatgtcaggagtcgaccgaatgattatggtgagttattagttatcttcctactaaagtcatttattcattttaggaaataaatttggaaacgacgatgacgtggcgcccaatgagctgctcaaggattttgtgtataaacctaccgactctccgaatcttccacttaccattttagaatacatatgtattgggtggttcacatttgaa