Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C34B2.7   

sjj_C34B2.7 RNAi (5)
PCR_productsjj_C34B2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C34B2.7 Source_evidenceePCR908WS150 Sequence/Annotation Release
Chunk_score Abs_score824
Max_abs_score824C34B2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1068455910685697
Overlaps_transcript C34B2.7.1 Source_evidenceePCR908WS150 Sequence/Annotation Release
C34B2.7.2 Source_evidenceePCR871WS150 Sequence/Annotation Release
WB_DNA_textsjj_C34B2.71139accctctcctcgtgatccttcggtgatcaaacatccaactccgtagattccagttggatggaattgaacaaactccatatcagaattacgaatacctgcacgagcggtaagagcggttccatcaccagtacaagtgtgagcagatgtacacgagaagtaagctcttccatagcctccggtggcgaggacagtgttctttgcgcggaaacgatgaatctgtccagtttcaatgtccagtgcaacgacgccaatgcattttcccttatccataatcaaatccaaagcgaaatactcgacaaaataattacagtcgtattgaagagatgcaccgtagagggtatgaagaagtgagtgtccagttctatcggccacacagcaagtacggtgagcctgtcctccacgaccgaaatcattagattgacctccaaaagcccgttgataaatttttccgtctgttgtacgcgagaaaggcattcctgcaagaaaattgttgttttttaatgttagagaatcttattgaccgtaattttcaagttcaataatagctctttcggcttctcgagtcatatagtgaatcgcgtcttgatctccaagccaatcggacccttttacagtgtcgtagaagtgccagcgccagttatctggattcatatttcccaaagcggcgttcacacctaaaaatcaaaatttaaattctgttcgtatactttgagcggctcacctccttgagccgcgactgtgtgcgatcttgtggggaaaagcttcgtaatgacggcagttttcattccaccttcggagagtcccatcgcagctctcaaaccggctcctcctgctcccacaacaaccgcgtcaaaagtgtgatcaacgacatcaaaattggtggttgcgctcacttgttttctttgaaaattgataaaattagtgaaatggcgttagaaaataaattatctcacttcatataagtgcgaacaggtgttttcgcacggtttatcgactttacgacattaagcatcttgctgaaaatacaggaaaaatatagaacgttcagaaaaacaaataaaaatccgataacggttgaggtgaaaccaaaaatgagttggccgcgcgaacgatacaccgtagttcacactttcggtgcg