Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C34F11.6   

sjj_C34F11.6RNAiJA:C34F11.6
PCR_productsjj_C34F11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34F11.6 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (21)
Overlaps_transcriptC34F11.6 Source_evidenceePCR443WS150 Sequence/Annotation Release
WB_DNA_textsjj_C34F11.61661tagtcaggaaaaccgaaatttgaaatattcaatatattgaaaaaaaagcaatattataaaattcaattgagaaatgatcatcccaaacaatttaataaaatctgaaaaaatccagaagataccaaaatagtttggggcaagaatgtgcagaaaatctttttaaaaattttcagttattcgagtgacgcttgtacataaataaaaggtatattcaaacgataaaatgaagatgaacaaaatttttgaaatcgaaaattttttgtctcaatctcttcacaattttccaaatcgaaaaacgattaaacaaatcagttagacataactaaaactttgtccgacggattactgccagatctagtcgtttactcgtttttgctattttattcagtaggcggaatcgagaagaagggcaacggaaaaagggaattttttctgcgagaagcatggtgctatgggcaaccgtatctaggccatcttggtgaaagttgctccgttttgttcatgcaaatgtggggttggaaattatttgagaaaattgagagaggtttctttattcttaaaagatcttgcacaaaatttaccaaaatgagaaaaaagaggattaaatttattcgaaggattgttcatagtgtgttgtatgtcgtatccttctcattttccttctcgagatttcaatcttttccatggaaacaggccatcgatccgtcatcgcgattctcgaacgcacgaagaagggagaaaatttgtggaatctttgcccaatatctgaagaaatacctgtttggagcgcgatgttaacaaaaggacgtttggcaacgtgccagcaaaaaatgtttgaaagcgttgaaaatgcaatattggatgaaatttctaaagtttcaagtgattgcaatatttgtatacattgaaaaaaaatatttcgactaaaaacagctatcatttcatgagaaagaaaaaataaataaagtaaagttgagtaaaaagttaggaataaaataaagtttaatcctggttactttcttcgtgaaatgaccccacgtttctttgctatagatcaggacagagataagagaggaatttgctataaaatgagcaggttttgccataatcttcactgtgagttttcgcattctacaaagaagtcgccatggcccaatctgttccaccaggagacatccaaacccagccgggtacgaagatcgtctttaatgccccgtacgacgacaagcacacctaccacatcaaggtgattaactcctcggctcgccgtattggatacggtatcaagaccatcaatatgaagagacttggagttgatccaccatgtggagtcctcgacccaaaggaagctgtacttctggcagtttcctgtgatgcctttgcattcggacaggaggacactaacaatgaccgtatcactgttgagtggaccaacaccccggatggagctgccaagcaattccgtcgggaatggttccaaggagatggtatggtccgccgtaagaacctcccaatcgagtacaacccatagggattcttgaacttttccaaaacttcaataaagtttcactgatagctcgtttattttgttttacttgtttccagattttatgattttatgatattcttgtttttttttcggaagacaagcgagagtatac