Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C34F6.2   

sjj_C34F6.2RNAiJA:C34F6.2
PCR_productsjj_C34F6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34F6.2 Source_evidenceePCR852WS150 Sequence/Annotation Release
Overlaps_Gene (10)
Overlaps_transcriptC34F6.2 Source_evidenceePCR907WS150 Sequence/Annotation Release
WB_DNA_textsjj_C34F6.21133cgtggcaaacttccttcttccgtttgatggtaagtataaataggtgactgaccaattgtagaaccacattccggtgcaatggaagacaaggcaaagcttgtacaggcgtccgaactcaaaaagtttgccttcttcggtaagaatcatacggtttctgatcatctaatagtttttattgttttcaggagtggcagtctccactgttgctactttgatagcaattattgctgtcccacttctttgccttcatatgcaaactgttcattctggtctttccgacgagcttcttttctgcaaatcaaagaatgttgacatgagaagcgaaatcgagaagctttccgttattcgtgacaacggaagacagaagcgtcaaactccacaaacttgctgttcatgcggtattggagaaactggaccagctggagttccaggacaagaaggagcccctggaaatgacggaaaagctggacaaccaggagcaccaggagctgacgctgacgagcaaggttttcattacaaggctccagaattctgcttcgactgcccagctggaccaccaggagccgttggaggaccaggaccaaagggaccaccaggaccaccaggaggtccaggagagcttggaggaccaggacgtggaggaaaccgcggaccaccaggaccacgtggaccaccaggagaggctggaccagacggagagggaggacgtccaggacaagccggacaaactcgctcagctccatctccaccaggacaaccaggacaaccaggagaaccaggatcgccaggagagccaggaccagatggacgtgctggacatccaggacgtaacggaccaccaggaccaccaggagacaatggaggtcaaggagagccaggaaaggacggagaagatggagagaacggagctgctggagccgctggaccaaagggatcttgcgaccactgcccaccaccacgcactgccccaggatattaattcacttctctctaattttagtgaatctcattctaataaaaaattgcctcaattactcatcttacatcattcgcataatgaaataatggctctatattgagtatataactcccacgagtagttcgcgtaaagattcgcaaatggttcgcatata