Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C34G6.4_f   

sjj_C34G6.4_fSequenceCAGCATTTGGGGGTGTAAGT
PCR_productsjj_C34G6.4