Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C34G6.5   

sjj_C34G6.5 RNAi JA:C34G6.5
PF:GL1_3F2
PCR_productsjj_C34G6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34G6.5 Source_evidenceePCR684WS150 Sequence/Annotation Release
Overlaps_Gene C34G6.5 Source_evidenceePCR738WS150 Sequence/Annotation Release
Chunk_score Abs_score633
Max_abs_score633C34G6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI58730305874189
C34G6.6 Source_evidenceePCR7WS150 Sequence/Annotation Release
Overlaps_transcript C34G6.6a.1 Source_evidenceePCR7WS150 Sequence/Annotation Release
C34G6.5 Source_evidenceePCR738WS150 Sequence/Annotation Release
WB_DNA_textsjj_C34G6.51160gctgcaatggaaagagatccagaatgttgttcttgtaaaggtacatcgtcaccgtgtatgttttgtagaggaaaaccaaagcgagagaattataatgttgtaagtaatgaaatcttgtttttttcgatcacataaatattcaggttggaactccaggtgttcgtgctccagaacttttgtttgggattggtttgtgtcatccatcaatagatatattttcctgtggaattgttctcctttcacttgtttctgtaaaacatccattctttatgccaaaagatgaaactgaaaatattatgcatctcgctttcttactcggatctgaaactatcgaaaaagtaagtaatcaaaagttgacacaagaaaaaataactcgatccttccgaaaaaatatttggagcaaaatctaaatatttaaaacactttctcaaaatcagttgttcaaatcgtcgaaaatttttcaatttttttctgttttgggaaacattaaaaaaaatacagaagagatttgatgaacagctatgaaaagttagttaaaaataaataatttatggaaaatttgaagtttaaaagtgagcttactcaccttatagaaaaattccagcttaaactcaaaaattattttcagatggctcatagtgaaggactacgagtgacattatctgaaaaacttcctcccgcagattactatcatctaatattatgccttcgatttggtttcgatcatgttcgacgacactgttcttcgtcaagacaaccatgtacaatatgccaaaaacgttcgttcaataattcgatgggagtgtgcttttgtgagtcatcatattcatttcaaaagtgacaaattgctttcaggccgaaaaaactacgaaacagacatgttttctactggtggaaatgaaacagaattaatgacaatatacgtggatctgttataccgtacacttgaggtgaagaagtcttggaatttaaaatacattaatttattcttacaggctgatagattcaagcgatacaacgccgatcaactgctctgcctcattgaatcttacgataaacgtgtgaaattcaaaccgaaaccaatgtcgaatcaagatccattctaaattaaaatgccatcaaatacttacattactcttactccgaatttttctcgcttg