Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C35E7.6   

sjj_C35E7.6RNAiJA:C35E7.6
PCR_productsjj_C35E7.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC35E7.6 Source_evidenceePCR704WS150 Sequence/Annotation Release
Overlaps_Gene C35E7.6 Source_evidenceePCR704WS150 Sequence/Annotation Release
Chunk_score Abs_score641
Max_abs_score641C35E7.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1081805910819136
Overlaps_transcriptC35E7.6 Source_evidenceePCR704WS150 Sequence/Annotation Release
WB_DNA_textsjj_C35E7.61078acgtactcgttcaaatcccgaatcaggcccaaatacacgtagaagcgttggacaactgtccattctaaatcctagctggattactagttgaacaaaataatgaacatttgactaacataaaaaaaagtggaaaaatcaataattggttctgcccatatcttggttcgatttgagtgattttctttaaaacaaattttaaaacgaaataacaattgaatatttcagtgaccgcagcaatggaagatcttacactggacagcaaagtaatggaaagtgacctgatcccattggtcaaggaaaagagtgtcttcttaccacatgacagtattctaattgctaagaacaagaaaaccaacaaaatcggacaatatgtattcgatagatatcatcatcaatttcttgaggtagtcatgtccgacatcgaaattaagcaagaaatgccaaatatcgcgaagcttatcaatgtgacaatgagcacaaaaactgagcaagcaatcagtatcagatgtacccctggaattggagaactgaagaaattccattataatcgggagacagcatcatttgatccaatggaagaaaaggcaattgttgagagtgatgaggaaattcagagttttattgaagagattgaaaaaacgcagggtgagattaggagaagaatgtctaataatgtgaaaaagatttttgcagatattgtatgcaaaaagatcaaagcaatcctctggttttatcataatgtgaaaccatttttggcaaagaaacttgagaatcctgtcaagaaaagttagttttacatacatactttaactgttttttttttcacctaaaactgaaatattttcagataatgactacaaacgttacgttttcaaaccagtggagccggaagaaaaagtcgatgatgaaatggattcggtgtccgaaccagaatctgattctctctcgatgagctcctctagtcggagcagtagccgtagcagcctgtcgagcgatgactctttcgagatggtcgtcgatattgattttgttgagtagtggctgaaaactaataaaatacccttatacagtgcgcgtc