Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C36B1.10   

sjj_C36B1.10 RNAi (5)
PCR_productsjj_C36B1.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC36B1.10 Source_evidenceePCR895WS150 Sequence/Annotation Release
Overlaps_Gene C36B1.10 Source_evidenceePCR895WS150 Sequence/Annotation Release
Chunk_score Abs_score790
Max_abs_score790C36B1.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI87498658751045
Overlaps_transcriptC36B1.10 Source_evidenceePCR895WS150 Sequence/Annotation Release
WB_DNA_textsjj_C36B1.101181acagagtcgtctgctcggattgtagacaagcacctgacgaagtagctcaacggaatctttcatatcagagtaatcaatcttctgaagcaattctgatcataggataattttagaaataaccttaccgtattgtagacagtacttcggcgatctctttggaaactcgcagtctgattgtagagatatgccaaatcggctgttctttttgaagtatcaggttcatacgattgaatgatttctttgtatttcgtgttgctcacattcatcgatgaaacatcttctgcagttggaactccgaacatatcaaatacaacttctgcctgattcttggctgatttccctgccaggaagattccacctttaagcaattcaccaaagacacatccacacgaccaagtgtctgaataagttcgattagtctcacatagacggccccagagttatctcaccaatcttgcatccatagtttttggagcctagaagcaactcgggcggtctataatatcttgtgacatggtagctttgttgtggtgtcttcactgattcaatcgcagatgatccataatcagaaatcttcagaagaccagtgtcagcattgtacagtaaattctgtggtttgatgtcacgatgacaaatttcagactgaaatataaatattctatttggatcattgtacaacacgaaccttctccaaatgtgcttgtccacggaacaactgccaaacaatcagtttaacctcgataatgtcaacacgtcgattgttatccttcagaaactgatggagattcattgggatgtactcgaagattagaccaaggcagatacgacctaaaataacaaggttatttgaaattagataaggaattcgaaaaggagcattacacagaacttgaatacatagaactgtcgccttttaggaaaagaaattgctcttagcagaacatattttcaaagataagcttctcagtctgtgctcaccttcatgttgtttctggtaactaaagagaaggcggacaatgttcttgtgcttcaactttccaagttttccgagaatcttcacttccaatggacatcctttatgacgtggccatgtctttttgatgacaatttccatttggtggttggattctgtgcgtgcaattccacgatagacatttgaaaaggctccagatgcgaataga