Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C36B1.11   

sjj_C36B1.11 RNAi JA:C36B1.11
PF:GL1_4G6
PCR_productsjj_C36B1.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC36B1.11 Source_evidenceePCR761WS150 Sequence/Annotation Release
Overlaps_Gene C36B1.11 Source_evidenceePCR801WS150 Sequence/Annotation Release
Chunk_score Abs_score696
Max_abs_score696C36B1.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI87564278757433
Overlaps_transcriptC36B1.11 Source_evidenceePCR801WS150 Sequence/Annotation Release
WB_DNA_textsjj_C36B1.111007tttttcaattcatcgcctccggagacttcgctgcatgaaagggcgttgtctggattctgattcaggataactgtgccagtagttgatgtagaatgaatactggatttttttgatgaaatagacgaccgagaagatccttgacattcatgcgaaacatctgataagtgatcatctgtaacacagttttgttttcaacgatcagagatttttataagttaccatcgctctgcggagaaccattttctgagtctctctcaattgtcgcattagcatcataaaatgcatcctgtaaaatcattgttattcgagtattccaaatttatacttgatattgtaatagtcaaactcacaagcatcttgttagccagctctttgacgcgatggtagccttcaatacgattaaatttaataaattggatagcctcgttgagttgccgttgacgcaaattccattccacaatcgtttttgactgtgacaagtatttaatcacatcaatctgagttagttaacaataattttctaaaatttcttaaattctcactttttccaatttttcgtgaccagaaagaataatggcataatcaacaggattatcttcatgtagttcggatagaacatcgaattccatttgcaatctgactccaatctcttgtgaagcgattttaaactgaaaaatacattttattgaaaaatcaagagtgttgaatgagagcataccgccagtttttgcgcttttgacacgaaatctttgtgcattttgtgtggtccgacaaaagcacactttccacaaataactttctcttttcgatagaacattgccggcgtcataattgaagaactttgtttgagcgcatatttgcagccttcgtgacgacaaatgaataattgactgtgtggggcgaatatggaacagattgtgcaagttcccattgtgtcggtgtaagcggagcacttttgtcctgacattacatcttgatgaagaggaaatgtcgaggcaaattcagct