Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C36B1.4   

sjj_C36B1.4 RNAi JA:C36B1.4
Simmer:C36B1.4:Screen_A
Simmer:C36B1.4:Screen_B
PCR_productsjj_C36B1.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C36B1.4 Source_evidenceePCR795WS150 Sequence/Annotation Release
Chunk_score Abs_score711
Max_abs_score711C36B1.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI87272848728465
Overlaps_transcript C36B1.4.3 Source_evidenceePCR748WS150 Sequence/Annotation Release
C36B1.4.1 Source_evidenceePCR795WS150 Sequence/Annotation Release
C36B1.4.2 Source_evidenceePCR795WS150 Sequence/Annotation Release
WB_DNA_textsjj_C36B1.41182gggaaatcaatacacacggataatggacagaagacaaaagttcgaatctacttcttcttggatgcagcctcttcagcctcagcagccacacgttctgtctcaacaaccttcaggagagcctcgatttcttcagttgacaatacacgttgctgcagctcatcctaaaaaattaaaattaaggaccatcttcaatttaaaaaaatgttattactgaaaataatctcaggtggaaatcacttacattaacttttttcatgactgcaatctcgatattttgtgatcctggtggtacgacctgagccagcgactttacaaccaatttaagagtggtagcttcgtcgacagtattttcctcgctgtattgctcctcaaggtattcacgcactggtttctctcctcttccagtcgcgttggcaacgtactcgtagtaagctccagatggctcggttttgaaaagacgtggagttccgtcatgatcgaatcctccaatgagcattgaaattccgaatgggcgacgtcctggagattgtgtgaagcgctgaaaatcagtaaaagttatgcttgcataaataaaatatttatacctgcttcgtgtttgcaatatatctggagatataggcaacggtaactggatcttcaagagtcaacttgtacgactggcactcgatacgagcacgatcaacaagaacacgagcatctgcggacaatccagcaaaagcgagcatcacatggtcgtcgatcatatgaattttacggattgtgcggtcatcttgaagagctggaattgacttcttctcaacaccgataacaatgcaatcctttccgcgaacaccgacctgaaacattcataattataacttgaggttttaaaaataaccgtattattttgaaccataattcgggaaattttagatttttagatagataatatcaatcatctacattgaattttttgatttatttttaaatataaaacgataaatagatctaaaatcttcttgaatcgggtgcttcaattctagctgatatcatattcatatgaaagtgcaactcatataattttctgccaactgattttcatcaggggaaccactcaccgcagtcgaacccttcttgacagcttcctgggcatattccacttggaacaagtgtccatcaggggagaagatagtgatagcacga