Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C36F7.3a   

sjj_C36F7.3aRNAiJA:C36F7.3a
PCR_productsjj_C36F7.3a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC36F7.4b Source_evidenceePCR497WS150 Sequence/Annotation Release
Overlaps_Gene C36F7.4 Source_evidenceePCR497WS150 Sequence/Annotation Release
Chunk_score Abs_score380
Max_abs_score380C36F7.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI95660999568373
Overlaps_transcript C36F7.4a.1 Source_evidenceePCR462WS150 Sequence/Annotation Release
C36F7.4b Source_evidenceePCR497WS150 Sequence/Annotation Release
C36F7.4a.2 Source_evidenceePCR462WS150 Sequence/Annotation Release
WB_DNA_textsjj_C36F7.3a2275ttgaggaggtgattgtgaatcttcttcttctgaatctgaaattatacataaacatacatgcgatatttgagtgctcaaaatgtgctctaacaatacaaaaattgtaatttacactattttgaaatgatttttacattgaaagagcatacttcaaggagcaacaacgtttttttttaaatgtgaaaagtagtttcaacactcaaaacaaacagtgaagtgtgaaaaagtgagaggtgcaaaaaaaaccaaaaaaacgaaaaagcgaccattcttttgattctccaaattgtcttcttcctcgtctgcttcatcatcttcagaatatccacgtggcattccagaacctgaaaaggtgaaagtgcgacagcaaacaaaaaacattccgaaaaaatgtggaaattgagagaaatgggagcaaatagaagtaaagcttaaagtgcctagaagctgaaaataatcgaaaacaccactatagaatatctaaatagatggtttttcaagaattctattttctataagccgaaagaataaaaaccgatagaaagtactttcacaaagcattgaaaataaaatttaaaagctcaccttctggaattaaattcgagtttgtgaaatgattgtgagagatctctgaaaaaaaacttaacttaactttatgaaatattatgtatctttattatgagagctcttatgcatattttgcagaaagttttacatacaaacgataaatttggaattttaaatataaattgctgctccatttgacacatactcgttttcaatcaaaaattattagcaattaacttacgattaagagtgacttgtgaatgatggattccattgtcatttttggcaacgcaccgataaactccaaaatgagatgattgaacatttctaatttcaagaatgtgaacactgtggtattgaccagatacagtatgcgtctgaaaattgttcatggggcttgttggatattcttttcccctaggcaagtaatttgcctttctgtttgaatttttagagagctcgatcaaatttctaaatctgatttttagttgtcaaactcaagaaaatattatatcatcaactaaaaaattagtttacaaaaaacaaataaaatctaaccatcgcaacattgttactttcataaactggttctccatccttttcccatcccatttccggtcttggccatgcttctgttgtgcaaaccattcttgccattgagccaacacttgcttgcactgtttcagattgagcttgaacgagtgggggaactgaaaataggctaaaagtagtaacgccagtaaggattttgtctagataagcaaaacgaccgaataaaacactccaaaatattttgaattaaaaaaattccagtcaaagtgttggaaaattgcaaatttttgaaaaatatgagcttttaaggaattccagagcaatgtcgcatgttccgacccctagaatattttaacacaaataattaaaacaaaatcagagtataaaaggtatggaaaaattactgcttgcttcaaatcttataaattaattttttcaatcatatcaattattggaaaagagtacatataaatagctataatctagatcccctttaccagtaagtagtgtctctaaatcgtcgttgttgtcaatttgaatttcatgaataaaattggtagatacacacacacaacgacaaacactttttcacttcttttttctaaagtttctcttctcaccctccaaaataaaatgatgtgctcggtttaaaattggacaaaaactacgtaaaatggaggaaaagatctcttgaaatagaatagagaaggatgaattctaaccgaagaagagagggaaaataagaaacaaattgtttcgaaacaaggtgaaatataagtaaattgattgaaagtatgagtcatttaagagaaattccggagcaaatggaacatttcaatgcctcatataaattgaattttgtgaaagtacttacatgtaaccaaaagcttgacagtccaagattcatcaggtggaattccattacttgcaacacaaagatactcgctcatgtgttttcttgagacttttgtaagatgaagaacaggtccatggaacacacttgctgaaatgagaaaattcagaaaaaatataaactttgaatattgtttgtatactatagttgtcaacgaattatttatcttgcaaacttgtgatgtttctgggttttagtgaaacaaatttcaaattgactttagctttcccttttcatttttcc