Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C36F7.5   

sjj_C36F7.5RNAiJA:C36F7.5
PCR_productsjj_C36F7.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC36F7.5 Source_evidenceePCR795WS150 Sequence/Annotation Release
Overlaps_Gene C36F7.5 Source_evidenceePCR795WS150 Sequence/Annotation Release
Chunk_score Abs_score690
Max_abs_score690C36F7.5
Specificity_index0.494
Rel_score1
Map_statusUnique_ePCRI95750149576059
K07A1.5 Chunk_score Abs_score176
Specificity_index0.126
Rel_score0.255
F42H11.1 Chunk_score Abs_score417
Specificity_index0.299
Rel_score0.604
C04F12.6 Chunk_score Abs_score113
Specificity_index0.081
Rel_score0.164
Overlaps_transcriptC36F7.5 Source_evidenceePCR795WS150 Sequence/Annotation Release
WB_DNA_textsjj_C36F7.51046aactgctgccaatgtctgataatttggatccaatgtagcagctttttgattctagaattcaaaaattaaaatcaaaaatcttgaaaaaaaaaatgcaactttgttcattggctgaagtggtttctttcctccggcaggtgctccaccagctcctccaccatcctttttatcaaaaacattgttattaagaccagccagcgtttggtagtttggatcatgtgttgctgcttttgcaccgatatttgcaggagcttttggtccaccaggtgttgcagcaggagcacctccaccatccttcttatcaaaaacattattattcaatccagccaatgtctgataattcggatcgtgagtagctgcttttgcattctgatcagctggagcagctggacctccaccacctgcagctggagcagcaccatccttctttccaaatacgttgttattcaatccagccaatgtttgatagttcgggtcgtgggttgctgccattccgggttttgcatttgctggtggagctggtcctacacctcctgctccgccatctttcttttcgaaaacattgtcgttgagtccagcaagtgtttggtaatttggatcgtgcgtggctgaaagttacgagtttattgatttcaacatttatcgaatagacatgattgaatgctgtcaaatacttacccgccattgtaggttttgcatttggagcagcaggagctggtggggcatcttttgatgctggagtcggtgagctttcgcccttatcactttttccagtttttccactttttgtgcttgcttccgagttttccaacttgctaccgcctttctttttctgaaaattattctcatttccaaatcatttccaaattccaaatttccaaaaaatcaaatccaaatttccaaaatttcgaataaaatacctttccgcacaagaacagaacctgaattgttgcacacgaagtgaagaatatgtagaaaaacgatgacattaaatgcagcattttcctctctgaaaatgagaatttcgattcgtcaaaagtgaaatt