Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C37A2.1   

sjj_C37A2.1 RNAi JA:C37A2.1
Simmer:C37A2.1:Screen_A
Simmer:C37A2.1:Screen_B
PF:GL1_5D11
PCR_productsjj_C37A2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE02D9.1c Source_evidenceePCR849WS150 Sequence/Annotation Release
Overlaps_Gene E02D9.1 Source_evidenceePCR890WS150 Sequence/Annotation Release
Chunk_score Abs_score806
Max_abs_score806E02D9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI68005086801681
Overlaps_transcript E02D9.1b.2 Source_evidenceePCR890WS150 Sequence/Annotation Release
E02D9.1b.1 Source_evidenceePCR890WS150 Sequence/Annotation Release
E02D9.1c Source_evidenceePCR849WS150 Sequence/Annotation Release
WB_DNA_textsjj_C37A2.11174acaagaaggttatggtgccgctgctggtggctacggtggatacgatccatacaatccatatggagccgctggtggatatggaatgtatccaggtcaaggatacccaccacaagaaatgacttcacctttggatgccgagattcaggcagttttacgagaaattcatttggaagtaactggactggaaacctcgggtgatcagtttagaaatgcccgacgactcttaaactccgagaaagaacgtttggagaacaatattgatccagaatggctcgaagttgatgtggccaagccagttaaggtttgcaagaagattcttgttccgatttaccgtcatccaaacgtgggttatagtttacattttatcttttacaaaattcaattttccagttcaacttcatcggtaaagttcttggaccgaagggagcaactctccaaacgctatgcaagacccacaaatgtcatatttacattttgggacgtggatccaccaaggatcgtgagaaggaggctgagcttttggcatctggagatccacaacacgctcatttcagtgggccccttcacgtaaaggttgaaactgttgctccagcatacattgcctacggacgtgtcgctgcggtaattgaggagttgtcaagaattttgcaaccggtaaggaaaatagttttcagatattgtcatttcatttttggttttttgttgttgcatgtgtcatccacctttttactaacagaaatatccaaagtgtcgttatttttttcagattcatgaagatacaactccggctcatttgaaaaacggctccggagatggtgaagaaaaggaagacgaagaaaagaaagaaggcggagaaggtggtggaagaggtggacgcggtgggcgtggaggatttagaggaggcttccgtggaggacgtggaggattcggtggacctggtggaccaatgggaggaagaggtggaatgggaggaatgggtggacgaggaagaggaggccaagctgctgggtatgcattctaaaatataaattagttataaaaaataaaatttacaaaaattattaaaaccaaatttccaaaaattaattctaaaaattttaataaaatatataaatacatgaaaacatttgcagattccgaccatactaaaaaccccaaaaattcaccaaacgct