Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C37A5.1   

sjj_C37A5.1 RNAi (5)
PCR_productsjj_C37A5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C37A5.1 Source_evidenceePCR718WS150 Sequence/Annotation Release
Chunk_score Abs_score613
Max_abs_score613C37A5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1415938614160521
Overlaps_transcript C37A5.1.1 Source_evidenceePCR718WS150 Sequence/Annotation Release
C37A5.1.2 Source_evidenceePCR718WS150 Sequence/Annotation Release
WB_DNA_textsjj_C37A5.11136ttatcccagtttacccatctcctcagccactcacgtcacagtctgcgcggatcccaccaacgcgtgatcggctcccgagtcgataaccttctccgggtagtatggtgcataggatggatcgttgaacttgtcagccaacatttctggcacatcagaatacttcgagttgacgatagccattcctgtctgcaaactgggaccttggcctgaagtcaatgagcctaagcctaagccaaagcctcatcctaagatagggcacccagctgagtgcgggcctcacgccggcctctgtgcaatcaagtgcgaaaggtagttatttgaaagcggtcgacacgttcggagttccgcgccatgaggtccgcggaggcgccggccttatgttgtcttagtctaagccaaagccaaagcctaaatctaagcctgaacctaggcctaagcctaatatctagactaactagttttctcaccgcaatattcctatcaatcaggtaattgcattcaaagtcgtcatcatcctcgcctagcggattgagcagcgcctcggcgaccttcatccagcccatgaagaaagtgaattggaagactgtcaggatagggaagtaatagtcaatctaaataagaaatttgtatatgtacaaagttttggatccgcaagacccttaccgttttcgtatcttccatatccaaatgctgccttgtaaataggcaggtgaagaagtaaactctaactgcaaaaaacaccacctgcgggtaagcaataggaatcggcacccaatcatagttacacagggttgccatattcgagcggaaagttttgacctcctgccaaaccgagttgaataacggagctgctgggatgtttccgtcctcgaaaagtttttgtaatatcgccgaagaccagttcaccggcatccagtagttggtacgtccgttgtcacctcccaagattatggattcatgatcctgaaggaaccctataagattttgcagggactctagaagattttgtcgaaaaattggcctacccgctttgataatggcgtcatggttcggaaatcgacggcggacttttagggaaatatctcggaacactaggacctgagtcagtaccaggtatcggattattgtacgcttgg