Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C37C3.2   

sjj_C37C3.2 RNAi JA:C37C3.2
Simmer:C37C3.2
PCR_productsjj_C37C3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C37C3.2 Source_evidenceePCR884WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV78587167859884
Overlaps_transcript (8)
WB_DNA_textsjj_C37C3.21169tccgccgatgtgtatgtttatcgccagttggctcgccattggacacaaaaataaccattgtttttcagaccccacgaagtactttggctgtgagctcggggctcaaacgaacttcgatgccaagaacgagcgttacattgtcaacggcgagcatgatgccaacaagctccaggatattttagatggtttcattaaaaagtttgtgctttgcaaatcatgtgaaaacccggaaactcagttggtacgagatcattgaattaataatctgtctaattttattatttcagtttgtccgtaaaaataacatcaagagcaagtgcaaggcatgtggatgttcgttcgacattgatctcaaacataagctgtctacattcatcatgaagaatcctccaaagattgatgtcgatttttgtaagtatcgtttactaacatttttcgattgaacttatgcaaaattctgccaaaaattctatttgcattttaaatcctttcaattcgattttccgtgtgcttccagtgcatacaaacatgctaatttttggtttccagccaaagccgaacaaaagaatggaaagaagacatcgggtgctgacgccgccgccgccgtggctgccgacataatccacaacagcgacaaaggcagttcgaatgatgacgacgacgacgattgggaacctgaaccagtcgagccgaatggcatgctgtcggcgggaatgggcaagctcgtgctggacaaggatcttgagaagagcgaagaacagcgtctcgacatgcttcacacattcttcttgaaagccaaggaagaaggtaagaattctgagcattgataaaaagtattctcgttatttcagatagaatttctgatgccaagggacaaactgctctacgtgacgaagctgagagacttgagctgaagcaaaaagcatctctccttctcgcgaacgtttttcttgatgagaaagtaatcactgacaaacaaatcagcaaacaccgcaatcttctgcttcgcttcacgttgaatgacaagaaagctcaaagatacctgttgggaggagttgagcaagtaattcacaaacatgaagcggaacttctgtctaaatcagctcacatcattaagtcattgtatgatgaagatgtctgcgaagaggattcgcttatttcatggggag