Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C37C3.2   

sjj_C37C3.2 RNAi (2)
PCR_productsjj_C37C3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C37C3.2 Source_evidenceePCR884WS150 Sequence/Annotation Release
Chunk_score Abs_score789
Max_abs_score789C37C3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV78587167859884
Overlaps_transcript (8)
WB_DNA_textsjj_C37C3.21169tccgccgatgtgtatgtttatcgccagttggctcgccattggacacaaaaataaccattgtttttcagaccccacgaagtactttggctgtgagctcggggctcaaacgaacttcgatgccaagaacgagcgttacattgtcaacggcgagcatgatgccaacaagctccaggatattttagatggtttcattaaaaagtttgtgctttgcaaatcatgtgaaaacccggaaactcagttggtacgagatcattgaattaataatctgtctaattttattatttcagtttgtccgtaaaaataacatcaagagcaagtgcaaggcatgtggatgttcgttcgacattgatctcaaacataagctgtctacattcatcatgaagaatcctccaaagattgatgtcgatttttgtaagtatcgtttactaacatttttcgattgaacttatgcaaaattctgccaaaaattctatttgcattttaaatcctttcaattcgattttccgtgtgcttccagtgcatacaaacatgctaatttttggtttccagccaaagccgaacaaaagaatggaaagaagacatcgggtgctgacgccgccgccgccgtggctgccgacataatccacaacagcgacaaaggcagttcgaatgatgacgacgacgacgattgggaacctgaaccagtcgagccgaatggcatgctgtcggcgggaatgggcaagctcgtgctggacaaggatcttgagaagagcgaagaacagcgtctcgacatgcttcacacattcttcttgaaagccaaggaagaaggtaagaattctgagcattgataaaaagtattctcgttatttcagatagaatttctgatgccaagggacaaactgctctacgtgacgaagctgagagacttgagctgaagcaaaaagcatctctccttctcgcgaacgtttttcttgatgagaaagtaatcactgacaaacaaatcagcaaacaccgcaatcttctgcttcgcttcacgttgaatgacaagaaagctcaaagatacctgttgggaggagttgagcaagtaattcacaaacatgaagcggaacttctgtctaaatcagctcacatcattaagtcattgtatgatgaagatgtctgcgaagaggattcgcttatttcatggggag