Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C37H5.6   

sjj_C37H5.6 RNAi JA:C37H5.6
Simmer:C37H5.6
PCR_productsjj_C37H5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC37H5.6a Source_evidenceePCR817WS150 Sequence/Annotation Release
Overlaps_Gene C37H5.6 Source_evidenceePCR817WS150 Sequence/Annotation Release
Chunk_score Abs_score796
Max_abs_score796C37H5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV48208574821673
Overlaps_transcript C37H5.6b.3 Source_evidenceePCR817WS150 Sequence/Annotation Release
C37H5.6b.2 Source_evidenceePCR817WS150 Sequence/Annotation Release
C37H5.6a Source_evidenceePCR817WS150 Sequence/Annotation Release
C37H5.6b.1 Source_evidenceePCR817WS150 Sequence/Annotation Release
WB_DNA_textsjj_C37H5.6817cttttccgatcgtctgaagcttctcaccatcagaatcgaacaattctgttgggaatggaccggttccgacgcgggtctgataagccttcacaacaccgataacgtttccgacggcggttggtggaactccgattcctgtgcaagcacctccgacggtggagttggaagatgtcacgtatggataggttccaaaatcaatgtcgagaagggctccgttggctccttcgacgagaacctgcttcccggcgttgcgttgctcgtggatgaatccgacggtgtcgccgacgagcttcaactcggcgagcttctcacgatgctgcttgaacttggcgagctcctcatcaacgttgacctcaatcgatgggaattgctttttgtagtgctcgacgagacggcgatacttctccgagaactcttcgaagtcagccataagatcggcgacacggattccatttctgaagcatttcgagctgtaggttggtccgattccacggttggtggttccgatcttgttcttggcggccaacgaatcctcttgacggccgtcaacttgagagtgaacaccgaaaacaagatgagcttcgctggagatcataattctcttctcccatcccgactcctcgagaatcccgttatgagcaagttccgagaagaaagcgtccaaattgacgacgactccatttccgatgacgttgaagcatgttggactgataattccactcggcaaaatgtggaaatcatacttccgtccgttggcgacgacggtgtgtccggcgttgttgcctccctggcatcgggcggtcacattgatcttgtg