Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C39E9.13   

sjj_C39E9.13 RNAi JA:C39E9.13
Simmer:C39E9.13
PF:GL1_5E2
PCR_productsjj_C39E9.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC39E9.13 Source_evidenceePCR772WS150 Sequence/Annotation Release
Overlaps_Gene C39E9.13 Source_evidenceePCR831WS150 Sequence/Annotation Release
Chunk_score Abs_score789
Max_abs_score789C39E9.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1309607613097047
C39E9.14 Source_evidenceePCR78WS150 Sequence/Annotation Release
Overlaps_transcript C39E9.13 Source_evidenceePCR831WS150 Sequence/Annotation Release
C39E9.14a.1 Source_evidenceePCR78WS150 Sequence/Annotation Release
C39E9.14b Source_evidenceePCR73WS150 Sequence/Annotation Release
WB_DNA_textsjj_C39E9.13972gccgtctgatgttggaatctatgatcgagttgttgtgcaggatctcgttaaagaaatggcacaaacgtctcaaatcgaatcaacttctcaaagatcgttcaaagttgtcgttctttgtgaagcggactcactgactcgtgatgctcaacacggacttcgtcgaactatggagaagtacgcgaataactgtaaaatcgttttgagctgtgaatccctgtcccgtatcattgagccacttcaatctcgttgcatcatcatcaatgtgccagctccaaccgatgaagatgtgaccaaagtcttgcggaaagtgattgaacgggagagctttctacttccggagaacgttttgcaaaagattgtggagaagtctgaaggaaatctgagaagagctattctgatgactgaggctttaagaatggagaacgagagtggtgtggctgaaagtgtagtaattccggttccggaatgggagatttatatccaagagactgctcgtctgatcctccagaaacagagctccgatatgcttctgaaagttcgcgaacgattgtacgaattgctctccagatgtattccaccaactgtcatttttaaggtgagttataagcacacaaatagtataaaatgttcaaaaatatttagaaatacattttcagaaacttctcgagcatctccttcccaaatgtccgccacaaattgcacgtgaagttgtcagtgaagcagcgaaattcgagcatcgccttgttctcggacaaaaagcaattttccatcttgaaggattcgtcgccgctttcatggacatttaccttactaatgcttctaaacccaagtgatctctgtccccgcgtattatattattctacttttgtgtaatcataaacttgaaacgaactacattatggttgtgtgggtatttacagaaacagcatataataaaaatcgtatcgcaaaggagaataaaatgaccggcga