Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C40H5.6   

sjj_C40H5.6 RNAi JA:C40H5.6
Simmer:C40H5.6
PF:GL1_7D7
PCR_productsjj_C40H5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene (5)
Overlaps_pseudogene C40H5.6 Source_evidenceePCR445WS150 Sequence/Annotation Release
Map_statusBest_ePCRX1177512011776131
C40H5.8 Source_evidenceePCR386WS150 Sequence/Annotation Release
Map_statusTop85_percentile_ePCRX1177512011776131
WB_DNA_textsjj_C40H5.61012tgaagaaagggtggaaatgcttggcttgcgacgtgttggatggatcttcacagattgttggacagcttatagtgctgaagaaactgtacattatacaaagcacaaggtgagaacaatctagaagagaagcccaaaaaacgaataatttttcaggattccttcttcctatcagctgaggagtgcatcaccgcagcaatgcttcaaaattaacatccaagtactcgatggatcgtcactatggatccaaaattggcttatgttcgagaaacaccattatccgaagaaaattatataactgatgttcaattttcgatgaaaaatgagtatggagccgaggttatgaagcacggacgaccacttccagttgaatatttgctggtggatgttcctgccggaatgccaaaagagcctcactacacgttccacgttggcacatctaataaatcgaagagtgccaaatttaatgttgaaaatcgacaagcaattggacaacttcaaggatgtgcaaatttgattcaatactcatccgaacctcgaatggttgcaccgccggcggctccattgccgaaaaagaagaagtatgcggataaatgtattcacccaaaggtttttatttattcttttgtcggaaatttaaatttttaattttcagatttgcaatctcgagccagacgcagaaaactacatggcaatcctggccgaagctttgaaacgcccgagtaaagccaagaagcgtcttcgaatttacatttcacacacttttatcgaagagaggcaaccggagcaggataccgatgaagcttctcttccgatgtgggaacttcgtgtcgaaggacgacttctcgatgagcagcctgcggctcctgctattccagagtgaatagaatgagattaatggaagtgatttatggaatgatattcaaactcttgatcaaaagtgttatgatattatcgaacagatcaacgaactgaaggctcgccgcgatttctacgcaagattctacaccgagcc