Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C41G6.13_f   

sjj_C41G6.13_fSequenceTAATGCAAAAATTGCACATTGAG
In_sequence C41G6
Y75B12B
PCR_product (2)