Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C41G6.2   

sjj_C41G6.2RNAiJA:C41G6.2
PCR_productsjj_C41G6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (2)
Overlaps_Gene C41G6.2 Source_evidenceePCR514WS150 Sequence/Annotation Release
Chunk_score Abs_score518
Specificity_index0.328
Rel_score0.488
Map_statusBottom50_percentile_ePCRV1524072515243002
M01B2.11 Source_evidenceePCR1125WS150 Sequence/Annotation Release
Chunk_score Abs_score1062
Max_abs_score1062M01B2.11
Specificity_index0.672
Rel_score1
Map_statusBest_ePCRV1524072515243002
Overlaps_transcript M01B2.11 Source_evidenceePCR1125WS150 Sequence/Annotation Release
C41G6.2 Source_evidenceePCR514WS150 Sequence/Annotation Release
WB_DNA_textsjj_C41G6.22278aaaactgccatgaatcgagtaaaagccaaaaagttgcaatcccagccatcatatatatcgtattttttggcttgttaatcttcccaacccaactcttcgtgtgagatttgagagatataattcttataaaacacaataaaattgccaaccaaactgctagtcgatgccctaaagcctccagtttctgctgcagtttgatcactgggataaaatctttatagtcgctgcgtaaacatggcggaggaattggattgatttcaggtagcagtgattgtttaatggcaaaataatgtagatttacaagtgctgctgttaaatcagcaatacaaattccagtaattattgtatatattcccaaagatcgcagttccttgtgaagcaaaataaatagatgaaataaatttgaaaagcaggaagctatccaaaaatagtcttgaattagtgtaccaaattgctcaactgcatagagaacgttgtataaatcgaatgtggaatttatttcaaatgtctccattctttaaaaatcaaaaaagaaaacaaaaaataactcctggaccccaagttttgaaatataaacatttatcaatgagctccaactcaaaacattttccgttgcatatcgatttctatagattcatggcaatttatcgggcatggcattccaattgtaaacatttcaaagtttcgcacaaatgaaaacttatttgacgtaaaaatgctatcaattgtaagtaatccaaaaaacctaaagcatttaaaagttgatttgctgaacgatggccacagtttttaagagtcatgaaaaataactgttttctataaaataaaagcttgagcttgttggacaatttttataagagttttctgacaaaaaactttgaacaacttcaactgtataaatcgcagccatatgttattttactcaaaaataaatcagttgtccctcgcttgatagatggtttgtaatgaaatatcttcaactacataaacttcccgacgtctccaaaatgctaaactttttaccgcattcttatactgaactgacataaaataacaaacaaagacatttgatatagagttcagagttctcaggttatttgagatggttaacgcagtagttattatttttctaaaaaataaaaaagcattatttgagttttgaattgatttttgtaaactttacatagaaattgcgtcaccactgtaatcaattactgtaagagctccgacacattgagtaatggaaaacgcaattgatatgaacaggatgagttttgtgttaactgcagcttcaacgttattcgttccagataatcgtcgtcttcgtctcagaattgtgcgtagttgaattgataaatacactgtcaacgagagatgacaaattgcagccataatttttagctgagaactgagttcgaaaatgtaactgacaattcgttgaaaatttgtaggaattgcatacacatggatctgttttatatatttttccggcaatactttgcatctgaaaatgatttctacaaaaaacaagatacatcggctttgtttcttccaatttaaaaataacttacatatcgtccacattatctggcaaccaaaatactgtagtgaataaaaactgccatgaatcaaaaaagagccaaaaagttgccaccccagtcatcatatagattgcaactctgggcttgttaatcttctcaacccaacgcttcatatgaaattttacagatacagctctgatgaataccaataaaattgccaaccagactgatagacgacggcctaaagtgtcaacttgctgcctcagccttaacaaagggataaaagatttgtagtcgcttctcaagcactgtggaggaatagggtaggtttcaggtagcaatgagagttttacagcaaaattttccaaactaataatagcaattgttaaatcggcaatacaaattccaatcatgattgtgtaacttccggatgatctcagctctttgtgaagcagaataaataaatggaacaaatttgagaaacatgaagctatccaaaaatagtcttgaaataattgaccagacaggtcaatcgcatgaagcagatcatataaatcgaatgtatcggtggaatttatttcgaagatctcatattcatcggtggaatttgtgaagttttcttcgaaggtatcctccattagaaaataaaaaaagtgacagaagcttgtgatagtcagatggtgctggctcacatataattatgcttcgagttagggaaagtgcagctgagttgtagt