Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_C41G6.2_f   

sjj_C41G6.2_fSequenceAAAACTGCCATGAATCGAGTAAA
Length23
In_sequenceSUPERLINK_CB_V
PCR_productsjj_C41G6.2