Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C43E11.6   

sjj_C43E11.6 RNAi (5)
PCR_productsjj_C43E11.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C43E11.6a Source_evidenceePCR863WS150 Sequence/Annotation Release
C43E11.6b Source_evidenceePCR863WS150 Sequence/Annotation Release
Overlaps_Gene C43E11.6 Source_evidenceePCR863WS150 Sequence/Annotation Release
Chunk_score Abs_score822
Max_abs_score822C43E11.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI42340104235165
Overlaps_transcript (7)
WB_DNA_textsjj_C43E11.61156ctcaaatgccacagctaccaattgaacaggatcgtccgacaacttcaatgatcacaaaagaagaaattgagattcgttcgaagattgctgctcttgaactggaacttgatgttactcataagaaagcagagcaatatcatgaagtgttgagctcaacgaaatcacattgtgatcaactggaaaagcagaatgagcaggcaaattatatgattaaaaactatcaggaaagagaaaaagagttgttgaatcgagaagagaatcatgtggaacaattgagagataaggatgtacattatgcatcattagttcgtcaattgaaagaacgaattgatgagttggaatcgaaattggaagaagctgaagagagaaggcattctattcagaatcttgagcttatcgagttgagagagaagttaaaggagaaagttgagaagaggaatgaaggaatggcgtatagaccaggtggagagcttcctcacgaggataaggctgttatggttaatttggagactattgtaagttggagaaaatatgaaagaacattcatcttcaaacttcattctaaaacagttttcacataatgcctaaaattaagcttgagcgtaggccctatgcctaagcctaagcctacgcctaagcctaagactaagactaagcctaagcccaagtaagaaactaattataacacccattttcatttccagactccatcaaccaaaaaagatgcggaagtatcagttggaagtagttggacagaagagtactcatcaccatgcgagtcgccagtccctcgtatctccgagccagcatctccggctcttccacataaattgacgcatcgcaaacttctgttcccactccgaaagaagtacgccgaaaacgagttctggcgtgccacgtgtcaaccagttggtcttcaagctcttcattggacggtggacgatgtttgtcagttgctcgtttcaatgggcttggacaaatatgtgccagagttcaccattaataagatcgatggagccaagttcctcgagctcgacggaaataaactgaaggtgagtaagatgtatacgatcccggcgcaagaaaactcgggtagaaaaaaaaaacgctgcaattacataacgaaaagttaaactatttcgtaggcaccaaggtg