Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C44E4.2   

sjj_C44E4.2RNAiJA:C44E4.2
PCR_productsjj_C44E4.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC44E4.2 Source_evidenceePCR874WS150 Sequence/Annotation Release
Overlaps_Gene C44E4.2 Source_evidenceePCR874WS150 Sequence/Annotation Release
Chunk_score Abs_score830
Max_abs_score830C44E4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI46314004633097
Overlaps_transcriptC44E4.2 Source_evidenceePCR874WS150 Sequence/Annotation Release
WB_DNA_textsjj_C44E4.21698aggcagagaagccaaaacaatagcttaaagcttttgtaaaaatttcaggtttaagatgttttcaaaactattacaattatgaaatttaaaaaaaaaacttaccaatttcatatggaatcgtcttttttaaatccaaaatccttgaaaccagagatccaacaattttccagagtctcggttccatcgatgtacaaatctcttctccactgattttcagccattcacaagagtcaataaatttttcagtgattctttgaacaagaacatcagttggtgatagactaattaatttctcaaaaatgatgagagtattctttttgacatttggatcttttttcgataaatgtggccataactttttgattagctcgtcgtagatgtgaagtgaagattcgtaaaatgaaatgtcttctgaatcttgaattgccggttttttattttcttggaggcgtctggaattactttggaatttttttaagtgaactgtttgaatctgaatcaatttattttgaaaatgatcagccctcgaaccatgggtctcgttaggtatttggagcaggcctgccggtttttcggttttccagtttttcgatttttctcgaaaaaaagaaaaaactgaaaaattttctcaaaaaagtgaaatttctgttttttttgtatgaaaaagtgcgtaaactgtaataaaaatattggattctgaataagaaataccaatttggaagtgttttcagattttttttttcggttttgccaaaaatgaaaattttcgatttttcggttttgttcaaaaaaaaaacgaaaaatcgaaaacaaattcggcggcacctgattttgaggtaaaaccgtaatttcaaacatttttttgattggtttcgcccattttcaagcatttttcttcgttttttaaaataaaagaatgcatttgaagttgaaaagtgaataagaattttttaatttgtttatgaatttcatttcatcaactttggcataaaattcattaaaacgacggaaaactaaacaaaaaaagacaaaaagtgcttgaaaattggtgaaactagtcagaaatgtttgaattttcggttttgccaccaaatacctaacaagatcaataaaacttgatgtacttattattgttgaaaactttcgggggctttaattaatttttttaattttttcttaaaatttaaacttccatacttcaaaattctcgccaacgctgcatagtacaattcgttcgcgaatgtttcatgatccttcatctcggagaataaatcaaaaatgctcttctcaataagaccagccgcttgtttcgccgagtctgggcttgaatcgattttcacagaatcccactcctgattcatcattttacgcgctgtttcttcaagatcagtgttccaaatagctgagaaaagtcgacgagtcaatccgaattcaagagcgaatcccttgcaaattgatgtgatctgttcggaacattttgtagaagatgcagtaatggaatccatatgcacaaaattagaagaagtcgaagaaaacttggaaatatcgattgattccatcatgattcgccattgtggttcaattgcaccttcggttatagatgtcattataggcatccaaacatccggagaaaatgttattggaggtagatttacaagttttttgattaaaattcgcattgcttcgcagataatgtcg