Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C44E4.4   

sjj_C44E4.4 RNAi JA:C44E4.4
Simmer:C44E4.4:Screen_A
Simmer:C44E4.4:Screen_B
PF:GL1_4E5
PCR_productsjj_C44E4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C44E4.4 Source_evidenceePCR883WS150 Sequence/Annotation Release
Chunk_score Abs_score841
Max_abs_score841C44E4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI46344224635359
Overlaps_transcript C44E4.4.1 Source_evidenceePCR883WS150 Sequence/Annotation Release
C44E4.4.2 Source_evidenceePCR883WS150 Sequence/Annotation Release
WB_DNA_textsjj_C44E4.4938cgcagaaacgaagagaatccagtaccggagaactcgttggagtactggcaaaaaatcaagcacagaactgtgtatatggtacgtttgtatctttctgattttgtctttacattatcaatttctcatttttcagaaaggattcagcactgacacccaattggacgacattattcaatgggccaatcaattcggagaaaccgagaacgttcttatgcgtcgcttgaagccaggagacagaaccttcaaaggaagtgtgttcatcacttacaaaactagagaggaggccgaagccgcacaaaaggctgaagttaagttcggagagacagagttgaccaagatgatgcaagatgagtattggactctgaagaacaaagaaaccaaggaagctcgtgctgcaaacaaggctgccaaatcagctaagaatacttctgaagcgattgaatcagaaaaggctcagcacgctgtccgttacgagaaaggtctcattctggccgttgatggacttggacctgattcaactattgacagcatcaagactttcttcaaattgcacggatctgttggatacgttgcacatgaaaatggaggcaaaacagccgaaatccgcttcaacaatgacagcgaaggagcgcagaaggcctgggacaacgctgttgcagctggaactgatggaaaagtcattcttcaagaggctgagctctccgcacgagttttggatggagaagaggaggagaaatactggacagagttcaatgccagaaagaatcagaggcaaggaggtggacgtggaggacgcggtggtcgtggcggacgaggaggccgcggtggtcgtggaggtcgtggtggaagaggtggacgcggagaccgccgaggtgataagcggtcagcaaacgatgaaggtgcagatggatctgatgagccaaaggctaagcgtactg