Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C44F1.5   

sjj_C44F1.5 RNAi (5)
PCR_productsjj_C44F1.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC44F1.5 Source_evidenceePCR935WS150 Sequence/Annotation Release
Overlaps_Gene C44F1.5 Source_evidenceePCR935WS150 Sequence/Annotation Release
Chunk_score Abs_score851
Max_abs_score851C44F1.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII37794333780632
Overlaps_transcriptC44F1.5 Source_evidenceePCR935WS150 Sequence/Annotation Release
WB_DNA_textsjj_C44F1.51200tgtgtttttgctattgcccactcataaactttgaatttttcattcaaaaatttatcagagactcaccgtattcacaattccacacacaaaaaggatcacaataatcaaaataatactgactgcgtgtccagcagatgtacgagtgatgaattgggagaatgtctgtaaatagcttaaattttgaaccaaatatcagacaaaacccacgtgaaagtaatcaatgtatagcatgagaagaatgaagaacataacagtcaatgctccaacaatcagtgctaaacttgtgataagtcttggcatcacgagcatatgatatatcccatagaccactagaaagaatatggaaattgcaagagatggtatgaaccagtgatctgtttccttgtgatattcagcttcaagaccagggttccgaaatctttggcttaatgtggagatgatggttgaatgttcgaccttcttcttttgcatatcaaacttctcctgacttttctctccttttcgctttttattcgttcccatggttttgagagttggattcatggcgacaatgctttggagcactcggttgacggcttggggtactgtcaccaatgagaatctgaaattaaagtatttagattttgttctgttacatttcataccttttattaacagggaaaagttctggtgatggtaagtgtccataaagtttccatccaattggacatttttccagttcaaattctcccgttgaaccaaggaaacgacgagtttcatttgatacgtagacacctctgaaattttcaaaattataaaaaaaaacttcaaaaaatgcttgttaggatagtggaaaacctgatctacctagttataaagttttttttcaaaattttagtaaaactcacggttcagttgcattactttgcatgagcagagcattatcaaaaactgatccaataacatcataatgccattttgaaactccaacaactccagccgtaacaggaccactatcaattccaatacaaaccgatacatctgctccagttgcatctcggaatgaattgatcaatgtctccaattccatcgaaaatctgcataactttgtcgcatgctgagaatcgattccaggaattgaacaaactgcagttattccttcagacgccactcgagtacatccatttgatgctgcaagacgttcgattcggctatcaagct