Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C45G3.2a   

sjj_C45G3.2aRNAiJA:C45G3.2a
PCR_productsjj_C45G3.2a
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F25H5.1a Source_evidenceePCR276WS150 Sequence/Annotation Release
F25H5.1f Source_evidenceePCR276WS150 Sequence/Annotation Release
Overlaps_Gene F25H5.1 Source_evidenceePCR278WS150 Sequence/Annotation Release
Chunk_score Abs_score215
Max_abs_score215F25H5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI92091029210615
Overlaps_transcript F25H5.1a Source_evidenceePCR276WS150 Sequence/Annotation Release
F25H5.1c.1 Source_evidenceePCR278WS150 Sequence/Annotation Release
F25H5.1f Source_evidenceePCR276WS150 Sequence/Annotation Release
WB_DNA_textsjj_C45G3.2a1514acttgtcgaacttccattttcaaatgtcatgtttttatgatgaatagtagaagaagtgtgagaataaaaaaatgcaaggaaaaggaaatagatagggtataagtataactgaattttgaaaattagattaattagagaaacattttacaaagaatacagatggagcatcctctttttcaaatatttcaacactgaaattgttttctttagtttttggcgaatgacgacttttggaacagagtttaaaagataaaaagtcttgaaaatttgaaaactaactctgtaagatggacgaatgttgttgtaagttctgtttacggcagttgttgcttggcaaacctgtaagcattcaatatttttaacatgagacagtagtaattgaacattttcagaattttgacaatccagttacaactgattgttttctaatttttgaaaataactcagtttcgggaaaaaactatggagaattcgcacgaattctccacatttttgatggtacttgttttggaaaatattttcattatttttgtggattacgggttaaatgtttttgtaaaagtacacgagacaccatgtgatctaaaaatttcaaaatgttcatggaaattgagggacgttttagtggttgcccaacacgaaagagactcaaaggattaactttctttttacttttattttgttgtttttcatttacttttgcataaccatttattttatattaacttcaaatgaaactcaccttgaatgcagctggatcttcagttttatcaagtttctcatactcaacaaatgctccttcttcctcattttccggcttttcgttttcatttccatacgacgagtactgaaattaaaagtttatcagaattttttacgtacactttttaaatgtgaagaaacaaaatttacctccgaattgtgattttttatttcaattattatattttcaaattattattacattttatcgcatattttagtgtttatctaaattcaggctttttttgcttttaaccgccataaaacttttagaaaatttatcaaaatgtttgattatgaaactgtttattgaggccatattgagtttattaaataattatttttaaatctaacctctggatcatcagtaacatcttcaataaccattccatgatttgaattattattatttgaattattgttaccaccgcctcgatatggattattcatagtggacaacatcatctgaaaatgtctttcatttgaaaaaagaagaaactagaaaacatgtatgaaaatggaaattagttggtcgtatattggcatcccattgagaacaaattgaataaggaacatgtaaagaaaaagaattgagagattaaaaattagaagagaaatctgagaaattagagagaaaaaggaaagaaaaattactggttcaagtgtatgtaattatggaaaaatagtttacgatcgagcggtcgatctaacatatcctctatttgtagtacactttttgagatttcggttca