Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C46H11.4   

sjj_C46H11.4RNAiJA:C46H11.4
PCR_productsjj_C46H11.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C46H11.4a Source_evidenceePCR760WS150 Sequence/Annotation Release
C46H11.4b Source_evidenceePCR760WS150 Sequence/Annotation Release
C46H11.4c Source_evidenceePCR760WS150 Sequence/Annotation Release
Overlaps_Gene C46H11.4 Source_evidenceePCR760WS150 Sequence/Annotation Release
Chunk_score Abs_score697
Max_abs_score697C46H11.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI50384045039829
Overlaps_transcript C46H11.4a Source_evidenceePCR760WS150 Sequence/Annotation Release
C46H11.4b Source_evidenceePCR760WS150 Sequence/Annotation Release
C46H11.4c Source_evidenceePCR760WS150 Sequence/Annotation Release
WB_DNA_textsjj_C46H11.41426tcctgtcgtcctactcgctttatactaacactattacaaaatttattggcttattgttaagcagcgaaaaaaaaaactaaaaatgaaaggttataatcagaacaagtaatattgaaggaatgtacaacatgatgatttcaggtatccgtcgagactatggccatcacagcgttgccgatggatgtttggctgaaagaacgactcaagaaatgggtgcagttatcaggacatgaaggtttgtgtcgaaccagagatgaaatgacggaaatcagtaactgaaaagttttacaggaagcattgtacccgccacgcctcatacgttatacaagaaacagtgtgcaaattgtggagaaggaagagcttataagaatatttcaaaagacccagcacttgatggattcacacctaaatattatgatgaactggagaaaaatgaagagcgtaagcattttttttttgaaataatgacaaatttccaaacttttctgaacttttcatataatttaaatatttttatttattcagattttatcgaaatcgaagatctcctgcaacagttccatgaccccacaaaaaccgcaattatggacatcaaaatcggaacaaggacatttttggaatcagaagtatcaaacaccaaaaaacgggctgatctttacgaaaaaatggttgcgattgataatgacgagccgacagaagaggagagaaagtgtggagcaatcacaaaattacgatacatgcagtttagggaacgagagagcagcactgcacagctcggatttcgaattgaggcagccaaggtatgtgaatgggtctcgaaccggccgtatatataaaaattaaaatgtatgcgcctttaaaaagtacagcagtttccacggttcactttaaaaaattgcaaaatagagaggtttgaagactacagtttttttaaaggcgcacactcgttcatatttaaatatgtgatcgtgtcgagaccggctactctattgttgaagtttttggtccttacttggctcaaattagagctccagctgtgtacctgacttccgcagtgctcaaagctttaatctttataaaacatatgtttttccatccaattcatgggtatatttagaattctaaatgttaacataacaagttttcttcaaaccctaaactcttcaacatcgcatttatttccagaggctcgaaggcgcattggagaaaaacttcaaaaaagtacgaacagttgaagatgtcacaactacatttatggacttctttggaactcaaagaagccgtgtaagacaacaattaattgaacgactgaaatcaatgcgaaaagccatcgaacattcatcattcttcaattcacatgaagtcgtcggaagcagtattctgattgtttttgatacggaaaaagtgggatgctggatgattgact