Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C47B2.3   

sjj_C47B2.3 RNAi JA:C47B2.3
Simmer:C47B2.3:Screen_A
Simmer:C47B2.3:Screen_B
PCR_productsjj_C47B2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C47B2.3 Source_evidenceePCR1074WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI1296522912966352
Overlaps_transcript C47B2.3.2 Source_evidenceePCR1074WS150 Sequence/Annotation Release
C47B2.3.3 Source_evidenceePCR979WS150 Sequence/Annotation Release
C47B2.3.1 Source_evidenceePCR979WS150 Sequence/Annotation Release
WB_DNA_textsjj_C47B2.31124tttggaacgacgtctcctctgtacaagaggcacacagccatgtactttccgtgacgtggatcacacttgaccatctggttagccggctcgaagcagctattggtgatgtcgctgacggacagagcctcgtggtaggccttctcagcagagatgagtggagtgtaggcggccaatgggaagtgaattcttgggtatggcaccaagttggtctggaactcgttgagatcaacgttgagggctccatcgaatctcaaggaagcagtgattgaggagacaacctgtaaaaagagaacattagaatacaacaatcaaattgagctcaacaaacctgggagatgattctgttgaggttggtgtagcttggtcgctcaacatccaagtttctgcggcagatgtcgtagatggcctcgttatcgaccatgaaggcgcagtcggagtgctccaaggtggtatgggtggtgaggatcgagttgtatggctcaacgacggcggttgagacctgtggagctgggtagatggagaactcgagcttggacttctttccgtagtcgacggaaagacgttccataagaagcgaagtgaatccggatccggtacctcctccgaaggagtggaagacgaagaatccttggagtccactgcagttatcagcgagacgacggatcctgtcgaggacggtgtcgatgagctcctttccgacggtgtagtgtccacgagcgtagttgttagcggcgtcttcctttccggtgatcatctgctctggatggaagagcttcttgtaggttccagtgcgaatctcgtcaacgacagttggctcgagatcgacgaagatggatcttggaacgtaacggccggatccggtgtctgagaagaaagtggtgaacgactctccctcgttcgttgattgagttggcatggttccatcgggctggattccgtgctcgaggcagtagagctcccagcaggcgtttccgatttggactccggcttgtccgacgtggatagagatgacctcacgcattttcttttctgaaaaagaaaattataaagttttaaaagagaaagacaattgttatatgagaacgaaacgattgcggtgagagcagagacgaaagtgagcccaa