Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C47D12.6   

sjj_C47D12.6 RNAi JA:C47D12.6
Simmer:C47D12.6
PCR_productsjj_C47D12.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC47D12.6a Source_evidenceePCR751WS150 Sequence/Annotation Release
Overlaps_Gene C47D12.6 Source_evidenceePCR775WS150 Sequence/Annotation Release
Chunk_score Abs_score628
Max_abs_score628C47D12.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1169330311694194
Overlaps_transcript (6)
WB_DNA_textsjj_C47D12.6892agacggtggtttttggagtgtgaatcttttccgtgataattctgactttgaactcattgtacttgaacatttccagcagatcctcttttgtcatttcaagacgctcgaacttttgcttatcttttactgcggcctttacgatttgatcgatcttcgggaaatcatcagggcagattgtgcggttctcatgccacatatcatagtagaaaccttcttggattggtggtccgtagcaaagatgacctccacaataacgctccatagcctctccgagaacgtgagcagaagagtgccagaaaacctgaaattaaattgataattatttccataaaaaactaaacaaaaaactcacttgcttagcctcatcatcatcaaacttcaagagctccaactttgcatttccttcaaatggacgatccaaatcccacacagctccgttgacttttgcgatgacggcggcctcggcgagtcccttggagattctctcggcgatttcgaatggagtagtacgccatgtctttccctcgtggatctttccgtcgggaagagtgatctgaattggctcagactctttggcagcaatttcagcgtcgtattccgccttcaacttgtcccaaagtttgattctctcctcaatgaacgccggccatggcgccatatcggttggggccttcgacattttctgaaattaaaaaaattaaattagtgaataactcaattcttaaagtttatacggaaaagtacgtacgtggccgttcacaaaatgatatttatcagaagcctcggaagaaagcgagcgataaaacggtttgaagatttgtgtcggtttttgaatgtgaacaaatatccggaaacagttcaatcgcatctaacgattcccataagaagctgc