Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C48B6.3   

sjj_C48B6.3 RNAi JA:C48B6.3
PF:GL1_8A10
PCR_productsjj_C48B6.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C48B6.3 Source_evidenceePCR615WS150 Sequence/Annotation Release
Chunk_score Abs_score531
Max_abs_score531C48B6.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69150646916243
Overlaps_transcript C48B6.3.1 Source_evidenceePCR615WS150 Sequence/Annotation Release
C48B6.3.2 Source_evidenceePCR615WS150 Sequence/Annotation Release
WB_DNA_textsjj_C48B6.31180aatcatcactcgagctgttcttcgagaactggcggtgcccaccgtcgttgtgattgtactgaggatctgacggaaaacgataagctgtggaatgactttgaaggatgtgctcaagctgtggctcgtctctattcggactcctcttggagaaatttcagaggcgctgcagagggaaccacgcagttgtacaaagtaaggaaattgtttaatttcatgaaaatcgattaatataaaaaattctaaatcgaatagaaaatttaaatgaatttaatttcagacatctactgacagttatcgtcgaggatttgagaagggattttcatcgggttgtacgagtattgccaaggaaatattacaagcatttcgagatccatccaaaattgatatgaacatagttctcgaagtattatacagaaatatggcaattccgcgagaggaacgacttaccgtcaatactcaaaacggaatctcatccgacaccttagcggcggttgaactttttcagcaggttagcatttttttttgctttgaaatctaacatattgtttaaacccctgaaaaatcgaagaaaagttttatgttgaggttctcatttatttttttgtttttcaggcactgaaccagccgcaagtcccaccgctgagcacattgagcctattgccaccgacaactagagaacagacgacagacactttggacgagtttctcgctagtcaggtgagcatattttatctataactttgaaaaatacatacaaaaaaaacgacaaaaaaagtaaaaattcctgcttcacacttatttttttaaaggttcaacgccaccgaaaacgtcagcgatcaccaaataactcaacgacatctccaacgtcacaaatgaaacgtcaacgacgtctttaaatctctcaaaaatcctcataattctcactttccaatctcttttattagaatttcccttcttttctagtagaagaaaactgaaaaacgttgcctttgacaccggtcttaaaaactcaaaaatgactgaaaatcccttttaatcactgctattattacttgtttttggaaatttcgaaagcatcgggtcttttgaatctcatggtactaatgcataagtagaaatctattatctaacctgaaaatgctttcgttttcaaaaataaggaaataaattttgaccccaa