Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_C48B6.8   

sjj_C48B6.8RNAiJA:C48B6.8
PCR_productsjj_C48B6.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC48B6.8 Source_evidenceePCR849WS150 Sequence/Annotation Release
Overlaps_Gene C48B6.8 Source_evidenceePCR849WS150 Sequence/Annotation Release
Chunk_score Abs_score725
Max_abs_score725C48B6.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI69200756921716
Overlaps_transcriptC48B6.8 Source_evidenceePCR849WS150 Sequence/Annotation Release
WB_DNA_textsjj_C48B6.81642ggttgcagtatggtgcattgcttgcagcatttggctcaatctaaattaatatttgaataatgttccaatgaacaaacttacagttcgtttaccaatttctccaatgctcagcttcatttgaattccttcttttcttttgatagctccaccggctgcatctgattccttgattttttgctccattctcttatattcttccattcgttccgcgtaatttactatcactttgtcctcgggtaactgtaatttttttgcgataaaaatagtgaccgatttgtttcaattaccataggtctactgtatctgttaaaattacttctagttgacactaatttcgaatattatatcttaagtctaattctattaatatttgaacgaagataaagctgaatacatattagaaaagattgtgcagcgccagtgtgagaattgttaaagaccactcttaaacagtcaaaaatgaaagtaaaacattaaaaaaaaagtttaagtatgattcttatattccaaaaatttggcattttgccaaaactataattttcgaaagctaaaaatgatttatcctgatacttgataattttaaattataaatggccctatatcacatctatacaaaaaaaaatctcaccctatataaatttggctcggttccaagatatccaaccacaactttaccgtctggtgccatcattgtaatggtattctcataggatttgctgaaatattaaaattcttattttaattctagaaatgtcaaaaactaacttataagagcaaactaatagtgcaactggtgacatttgagcattacagttccatacaagtttattatcttgaaatattagcaatgtatcgtcagatgttgaaactattaaacgattgaattgagtgttatctgattgagagtaaacattaataaaagtttgaaaatatatgaaatcttactaatcagaagtgatctataaagacacattgccattccaacagcttctaaacgaatctgccagacaactgatccagttgcattaaatgcagacacgtgtcggcggcataatacaatggttgttggtttagatccttcggttactttcatttgtattgcagtatcacccagattaaaagaccagtcatactgaaaaaaagaagactcaaatttactgtcagtgtaaagtcagcatatttgaaaaaatgttcagcgttatcaaaattcgacagcttgggtttattatttgtaattaactcaatactttttagtttcccgatgatattggacattcgaaaaatattcaatagtccacagcttacattaatctttttctgcgatccacttgacataagactgaatttgatagcagctaagaatccattatttgcaacaaaaagagtttgtgtagtctgacagtaaccgattggtcctggttgaagagctctcaatggaaccattgaaaaaacacattgatctccttgaaacaaagataatttacaatcaattgattgcactaatatctgtggagttgattcttcaattggtattacacacatattccatgcagatgttgaaaaagaatgagagaatatctcatcaagtgatgcgagggtttcatcaggacttgctgaaattttaaccatttcgtaccagggc